Книга "Пикотехнология белков" уже издана!

Список разделов Альтернативная Физика Уголок Кушелева

Модератор: Kushelev

  • -1

Сообщение #1 Kushelev » 27.08.2016, 22:46

Вкусная реклама книги "Пикотехнология белков"

Рецензенты:

д.ф.-м.н. ШУЛЬГА Сергей Михайлович;
д.б.н. БОЖОК Галина Анатольевна

Соколик В.В., Кушелев А.Ю.
С 54 Геометрия живого наномира. Пикотехнология белков / В.В. Соколик, А.Ю. Кушелев. – Харьков: Издательство, 2015. – 255 с.
ISBN 978-3-659-92862-8
Монография посвящена 3D-структуре молекул и полимеров живых систем. Дан анализ современного понимания таких фундаментальных понятий, как физический объём атома, химическая связь, генетический код. На основе статистического анализа экспериментальных данных о структуре белка обосновано кодирование его вторичной структуры и структурного полипептидного шаблона в геноме. Предложена дополненная таблица генетического кода белков и пептидов, которая легла в основу геометрического алгоритма программ декодирования структурного шаблона белка Molecular Constructor и Picotech. Сформулирована гипотеза о перекодировании информации третьего нуклеотида кодона в соответствующий ротамер пептидной связи непосредственно 3D-структурой изоакцепторной тРНК. Математический анализ сопряженности значений углов φ и ψ (карта Рамачандрана) выявил периодичность их изменения, что позволило обосновать механизм посттрансляционного фолдинга белка.
Книга рассчитана на специалистов, занимающихся исследованиями в области молекулярной биологии, биоинформатики, биохимии, биофизики.
Табл.: 36 . Ил.:117 . Библиогр.: 227 назв.


Sokolik VV, Kushelev AY
Geometry live nanoworld. Pikotechnology proteins / VV Sokolik, AY Kushelev. - Kharkov: Publishing, 2015. – 255 p.
ISBN 978-3-659-92862-8
The monograph is devoted to the 3D-structure of molecules and polymers in living systems. The analysis of the modern understanding of the fundamental concepts of the physical volume of the atom, chemical bonding, and the genetic code is presented. Based on statistical analysis of the experimental data on the protein structure is justified coding secondary structure and structural polypeptide template of protein in the genome. Propose additions table of the genetic code of proteins and peptides, which formed the basis of the geometric algorithm software decoding structural template protein, are Molecular Constructor and Picotex. The hypothesis of recoding information to third nucleotide codon in the corresponding peptide bond rotamer directly 3D-structure isoacceptors tRNA is formulated. Mathematical analysis of contingency angles φ and ψ (Ramachandran map) revealed their frequency changes as possible to substantiate the mechanism of post-translational protein folding.
The book is intended for professionals involved in research in the field of molecular biology, bioinformatics, biochemistry and biophysics.
Table: 36. Ill: 117. Refs: 227 titles.

ПРЕДИСЛОВИЕ РЕЦЕНЗЕНТОВ
В 21-м столетии в задаче моделирования нанообъектов таких как атом углерода, органические молекулы, пары комплементарных нуклеотидов и многих других используется кольцегранная модель строения атома. В монографии В.В. Соколик и А.Ю. Кушелева «Геометрия живого наномира. Пикотехнология белков» при помощи кольцегранного подхода к строению атома наглядно (образ – модель) реализуются различные виды, свойства и особенности межатомных взаимодействий, валентные углы в молекулах, разновидности химических связей и их соотношение. Кольцегранная модель реалистично объясняет гибридизацию электронов при формировании химических связей в молекулах, что является краеугольным камнем всей биохимии белкового мира, поскольку атомы углерода в состоянии sp3-гибридизации своих электронов входят в состав скелета аминокислот и таким способом детерминируют углы между химическими связями в их молекулах, а в последующем и в структуре белка в целом.
В монографии В.В. Соколик и А.Ю. Кушелева «Геометрия живого наномира. Пикотехнология белков» сформулирована идея композиционного генетического кода, кодирования ротамерии пептидной связи и структурного шаблона белка. Показано, что в геноме третьим нуклеотидом кодона детерминирован один из трёх ротамерных вариантов пептидной связи, которым аминокислотный остаток (закодированный дуплетом первых двух нуклеотидом кодона) присоединяется к растущей полипептидной цепи. Ротамерный вариант пептидной связи реализуется в процессе синтеза белка в рибосоме и поэтому с неё сходит индивидуальный структурный шаблон белка в соответствие с информацией, содержащейся в его гене. Данный механизм трансляции генетической информации является эволюционно новым. Его формирование у эукариот было обусловлено необходимостью синтеза больших и сложных белков в виде структурного шаблона, максимально приближенного к функциональной конформации этих белков, чтобы их фолдинг имел наибольшие эффективность и однозначность. У прокариот и органелл эукариот третий нуклеотид кодонов в генах небольших полипептидов ещё не является информационным, поэтому на нём и наблюдается воблирование.
Выше изложенные положения легли в основу алгоритма авторских компьютерных программ, которые по нуклеотидной последовательности мРНК позволяют смоделировать схему вторичной структуры и 3D-структуру индивидуального структурного шаблон любого белка. Эту первичную информацию о белке можно использовать в дальнейшем моделировании фолдинга функциональной конформации белка с учетом физ-химии его микроокружения, посттрансляционных модификаций, взаимодействия с лигандами методами молекулярной динамики и доккинга наравне с информацией о наиболее стабильном конформере, которую извлекают из рентгенограмм кристаллов белков. Преимущество данного подхода состоит в возможности быстрого моделирования индивидуальной пространственной структуры отдельной молекулы любого белка с точностью до электрона (пикотехнология), опираясь лишь на информацию о нём в геноме. То есть in silico воспроизводится трансляция генетической информации в индивидуальный структурный шаблон белка. Не исключено, что большинство белков именно из конформации своего структурного шаблона максимально быстро, а главное однозначно, фолдируют в нативную конформацию с минимумом свободной энергии, формиру таким образом «устойчивое большинство» конформационно лабильного белкового пула.
Авторами монографии предложен современный, точный и удобный методологический подход в арсенале молекулярной биологии для моделирования пространственной структуры белков, исходя из той информации генома о них, которой располагает сама клетка.
Итак, перед читателем книга, вводящая в мир идей и результатов, ориентированных на применение в протеомике кольцегранной модели и молекулярный полиморфизм, основанный на структурном разнообразии биомакромолекул. В этой области причудливым и невероятным образом пересекаются достижения многих областей современной науки: физики и химии, биологии и медицины, математики и информатики.

Доктор физико-математических наук С.М. Шульга

В настоящее время моделирование пептидов и белков относится к современным и востребованным методическим подходам, позволяющим не только дополнять, но и порой с успехом заменять условно гуманные эксперименты на лабораторных животных, касающиеся взаимодействия различных биогенных соединений с клеточными структурами. К сожалению, данными подходами владеют немногие естествоиспытатели, успешно работающие в своих областях наук. И в этом случае монография В.В. Соколик и А.Ю. Кушелева «Геометрия живого наномира. Пикотехнология белков» позволяет если не овладеть, то, по крайней мере, понять суть применяемых авторами методов построения моделей белков и их кодирования в геноме. Тем более, что книга очень увлекательно и доступно написана. Достигается эта легкость понимания материала тем, что в монографии четко прослеживается научная логика рассуждений и методических подходов авторов. Читателя знакомят с развитием теории строения атома, как с традиционными уже исторически устоявшимися сведениями, так и с новыми интерпретациями кольцегранной структуры атома и аппроксимации геометрии кольцегранной электронной оболочки архимедовыми телами. Авторы пользуются новой «системой координат», их пикотехнология – это технология электронного уровня, разрешение и точность которой сопоставимы с толщиной закольцованного луча-электрона (пикометр – 10-12 м) в атомах белка. Именно этот подход лежит в основе разработанного авторами геометрического алгоритма определения атомного радиуса.

Одним из важнейших итогов материала монографии В.В. Соколик и А.Ю. Кушелева является реальная возможность с помощью законов геометрии макромира рассчитывать положения атомов в молекуле, не прибегая к квантово-механическим функциям. Такие перспективы обеспечиваются ещё и закономерностями формообразования молекул, которые определены структурой внешних кольцегранных оболочек их атомов, которая, как показано авторами, типична для элементов каждой группы таблицы Менделеева. Сопоставление в монографии экспериментальных данных с представленными моделями протеиногенных аминокислот, рассчитанными геометрическим способом для шаблона многогранных моделей аминокислот, аргументирует убедительность и логичность методологии авторов. Кроме моделей самих аминокислот авторы уточняют способ объединения их в полипептидах, возможность формирования трех видов ротамеров пептидной связи (R, 0 или L-ротамеров), которые интерпретируются авторами в качестве прототипов соответствующих конформеров вторичной структуры в белках.
Через призму теории формирования внешней электронной кольцегранной оболочки атома авторы рассматривают последовательно весь геометрический процесс построения пептидов – от пространственной структуры аминокислот до вторичной конформации и этапов фолдинга белковой молекулы. Логичным фрагментом исследований, изложенных в монографии, является объяснение способа и механизма кодирования и декодирования информации о структурном шаблоне белка в геноме.
Детально охарактеризованы декодированные в программах Molecular Constructor и Picotech В.В. Соколик и А.Ю. Кушелева структурные шаблоны белков в качестве субъектов последующего фолдинга. Представлен количественный сравнительный анализ декодированных структур с соответствующими экспериментальными моделями из базы данных PDB. Особое внимание уделено способам описания пространственной структуры белка и характеристике элементов вторичной структуры, а также современным методам моделирования in silico.
Следует отметить, что данная монография актуальна не только как научный труд. Собственный интерес авторов к своей работе заражает, более чем полный массивный объем информации, увлекательная и яркая форма ее изложения и оформления делает монографию применимой также и в качестве учебника для студентов естественнонаучных специальностей, особенно таких, как биохимия, биофизика и биотехнология.

Доктор биологических наук Г.А.Божок


Вкусная реклама книги "Пикотехнология белков"

"Запретный плод сладок", поэтому самой вкусной рекламой книги "Пикотехнология белков" является секретное приложение "100 белковых структур", которые были определены мною с помощью программы "Пикотех" всего за один рабочий день. А в книге "Пикотехнология белков" как раз и объясняется, как создавалась программа, какие идеи легли в её основу...

Книга "Пикотехнология белков". Ссылка доступна за 6 USD
Приложение 1 ****** (открывается вместе со ссылкой на книгу)
Прилложение 2 ******
Приложение 3 ******
Приложение 4 ******
Приложение 5 находится в тексте книги
Приложение 6 находится в тексте книги
Приложение 7 https://yadi.sk/i/ZeW0a6y4hqKVp
Приложение 8 100 структур в формате PDB, PNG ... https://yadi.sk/d/nWEkBJRdhpP4D

Это те самые 100 структур:

Изображение

Вы можете претендовать на 426-ой электронный экземпляр книги.

***

Формы, механизмы, энергия наномира. Сообщение 80 141

Готовится 564-ый выпуск рассылки "Новости лаборатории Наномир":

http://subscribe.ru/catalog/science.news.nanoworldnews

Дайджест:

Издана книга "Пикотехнология белков"!
Как устроен кибернетический глаз-алмаз Тескатлипоки?
Отличить алмаз от пирита поможет тепловизор!
Фрактальное зрение инопланетян
Изображение

Изображение
Изображение
Изображение

Изображение

Изображение
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

  • -1

Сообщение #2 Kushelev » 28.08.2016, 10:39

Формы, механизмы, энергия наномира. Сообщение 80 154

Вкусная реклама книги "Пикотехнология белков"

Издана книга "Пикотехнология белков"!

FaceBook:

Издана книга "Пикотехнология белков"!
Подробнее: http://nanoworld.org.ru/topic/1453/page/15/

Изображение

В приложении-8 показаны примеры 100 структур белков, которые я определил за 1 рабочий день на одном персональном компьютере. Точность новой технологии (пикотехнологии) в 1000 раз выше точности нанотехнологии, скорость примерно в миллион раз быстрее. Кроме того, Рентгеном можно определять структуры только закристаллизованных белков, а это всего 3%. Остальные не присталлизуются. Для новой технологии такого ограничения нет. По старой технологии за каждую структуру белка в среднем кто-то платит 10 000 евро. Потенциальные заказчики сообщили, что они смогут заказывать структуры в лаборатории Наномир, если будет официальное разрешение от NCBI. Такой комплект документов может стоить от 100 000 USD. Зато имея это разрешение можно зарабатывать миллион евро в день, имея один персональный компьютер. Приложение-8 с примерами белковых структур можно скачать бесплатно здесь: http://nanoworld.org.ru/topic/1150/ Бумажный вариант книги стоит в издательстве типа 43 USD, электронный можно купить за 6 USD.
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

  • -1

Сообщение #3 Kushelev » 20.09.2016, 13:40

Вкусная реклама книги "Пикотехнология белков"

FaceBook: Вы уже прочитали книгу "Пикотехнология белков"? Достаточно набрать в Гугле ISBN, и он Вам покажет, где и по чём её можно приобрести. Электронный вариант стоит в 10 раз дешевле :)

Изображение
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

  • -1

Сообщение #4 Kushelev » 22.09.2016, 12:38

Формы, механизмы, энергия наномира. Сообщение 80 543

Вкусная реклама книги "Пикотехнология белков"

http://globalwave.tv/forum/viewtopic.php?f=20&t=497&p=18536#p18536

Велебуд Анишук писал(а):
Kushelev писал(а):Я могу не только читать учебники, но и писать
Ты же несколько дней назад согласился, что книгу писала Виктория Соколик, а ты тут не пределах...
Кушелев: Я и не отрицаю, что книгу писала Виктория Соколик.

Вот, например, фрагмент текста, который написала Виктория Соколик:

Изображение

Но в ней есть и фрагменты, которые написал я. Каждый может убедиться. Вот, например, фрагменты из книги "Пикотехнология белков", которые были подготовлены мною:

Изображение

Изображение

Изображение

Изображение

Чтобы приобрести бумажный вариант книги, достаточно набрать в Гугле ISBN:

Изображение
Бумажный вариант стоит около 75 евро, но есть электронный вариант, который стоит в 10 раз меньше: http://nanoworld.org.ru/topic/1150/

Кстати, в расширенном электронном варианте можно заменить статические иллюстрации на динамические 3D-модели:

Изображение
Это удобнее, чем по названию искать 3D-модель через Гугл.
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

  • 1

Сообщение #5 Поликарп » 22.09.2016, 21:34

Kushelev писал(а):Издана книга "Пикотехнология белков"!

И опять Кушелев не удержался от фальсификации.
Изображение
Поликарп M
Репутация: 12
Сообщения: 789
С нами: 3 года 2 месяца

  • -1

Сообщение #6 Kushelev » 01.10.2016, 13:34

Поздравляю! Вам удалось создать новый оксюморон: "Авторская подделка" :)
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

  • -1

Сообщение #7 Kushelev » 01.10.2016, 13:44

http://nanoworld.org.ru/topic/1453/page/68/

Skype:

[30.09.2016 23:17:21] Мария: "в мезосомы или липосомы РНК" ?? Это что так легко по вашему??

Кушелев: Если будет строго доказано, что эти РНК отключают механизм старения, то "легко, не легко" погоды не сделает. Согласны?

[13:17:39] Татьяна Рясина: Марина отключилась (swear) , на форуме не хочет разговаривать. Даже у крыс сильный исследовательский инстинкт - они неизвестный лабиринт на еду меняют. А у людей почти нет исследовательского инстинкта, люди любят только кормушку и известность. Гммммм. Самых "наукоёмких" вытесняют за обочину (как в фильме Сталкер прям) , а в НИИ сажают самых "исполнительных" )))))). Я это ещё из под стола наблюдала, родителей (оба к.м.н.) за "меньшие" вольности грызли по полной. Да, спрашивать буду на Форуме, конечно ))))) . До связи, пошла думать )))))
[13:44:19] Кушелев Александр Юрьевич: ОК! Значит, Марии книга "Пикотехнология белков" неинтересна, как я понял...
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

  • -1

Сообщение #8 Kushelev » 03.10.2016, 19:44

Формы, механизмы, энергия наномира. Сообщение 80 728

Skype, 2016-10-03:

[19:31:20] Татьяна Рясина: Интернет магазин с Пикотехнологией белков и козиной для заказа книги https://www.ljubljuknigi.ru/ru/search?utf8=%E2%9C%93&q=%D0%BF%D0%B8%D0%BA%D0%BE%D1%82%D0%B5%D1%85%D0%BD%D0%BE%D0%BB%D0%BE%D0%B3%D0%B8%D1%8F+%D0%B1%D0%B5%D0%BB%D0%BA%D0%BE%D0%B2

[19:44:49] Кушелев Александр Юрьевич: Благодарю за ссылку!

Изображение
Оригинал: https://www.ljubljuknigi.ru/ru/search?utf8=%E2%9C%93&q=%D0%BF%D0%B8%D0%BA%D0%BE%D1%82%D0%B5%D1%85%D0%BD%D0%BE%D0%BB%D0%BE%D0%B3%D0%B8%D1%8F+%D0%B1%D0%B5%D0%BB%D0%BA%D0%BE%D0%B2

Добавлено спустя 59 минут 28 секунд:
Вкусная реклама книги "Пикотехнология белков"

Изображение

А это - суперобложка от Кушелева:

Изображение
Оригинал: https://img-fotki.yandex.ru/get/103691/158289418.355/0_160218_38606b31_orig.jpg
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

  • -1

Сообщение #9 Kushelev » 12.10.2016, 22:26

Формы, механизмы, энергия наномира. Сообщение 80 867

Виктория Соколик писал(а):Приглашение на очередную 12-ю CASP конференцию (на этот раз в Италии) December 10-13th 2016, Gaeta (Italy)
Правда регистрационный взнос в 1000 евро и это без дороги -- кусается :).

CASP: Early bird registration deadline for the CASP12 meeting is October 10th
A reminder that the deadline for early bird registration for the CASP12 meeting in Gaeta is now very close - next Monday October 10th.

The second planning meeting, in which the assessors present their preliminary findings to the organizers, was held a couple of weeks ago, and there is some pretty exciting stuff. In particular, looks like substantial improvement in average "new fold" model accuracy, probably due to the new co-evolution methods. The new "is the model as good as experiment for understanding function" category has a team of four assessors, led by Russ Altman, and should produce substantial insights. Very intriguing comparisons between SAXS data, experimental structures, and models. Again we have a collaboration with CAPRI for modeling assemblies, with a more substantial body of data than previously. And, of course, many interesting results in comparative modeling, refinement, and accuracy estimation.

Registration: http://www.cevs.ucdavis.edu/confreg/index.cfm?confid=851&webid=4026

Specifics of the travel arrangements:
http://predictioncenter.org/casp12/meeting_directions.cgi

Additional information:

12th CASP Meeting
December 10-13th 2016, Gaeta (Italy)

The meeting concludes the 12th international CASP (Critical Assessment of Techniques for Protein Structure Prediction) experiment. The goal of the meeting is to discuss the state of the art of methods for predicting protein structure, assembly, and function from sequence, reporting and discussing the results of a blind assessment.


Confirmed invited speakers:
Russ Altman - Stanford University - USA
Alexandre Bonvin - Utrecht University - NL
Guido Capitani - Paul Scherrer Institut - CH
Matteo Dal Peraro - Ecole Polytechnique Federale de Lausanne - CH
Edward H. Egelman - University of Virginia - USA
Francesco Gervasio - UCL - UK
Michael Levitt - Stanford University - USA

Location

The meeting will be held at Hotel Serapo (www. http://www.hotelserapo.com/en/), on the slopes of the Natural Park of Monte Orlando in a beautiful and panoramic corner overlooking Serapo Beach, very close to the city center and the old town of Gaeta.

The city itself, the so-called Ulysses Riviera, is embedded in a fascinating area, full of surprises, natural beauties, history, art and culture. It is conveniently located between Rome and Naples. It overlooks the Tyrrhenian Sea. Its history as a resort dates back to Imperial Rome. Nearby sites include the first-century BC mausoleum of general Lucius Munatius Plancus. Its old town is mostly medieval, showcased by narrow alleys, the massive 13th-century castle and the 12th-century Cathedral of Assunta e Sant"Erasmo.


Registration details:
Deadline for early bird registration: October 10th, 2016
Deadline for late registration: November 14th, 2016

Registration fees (***):
Separate room Shared room
Early bird registration US$ 975 / ~850 Euro US$ 870 / ~750 Euro
Late registration US$ 1,125 / ~1000 Euro US$ 1,020 / ~900 Euro
Accompanying person (*) US$ 340 / ~300 Euro
Extra day before or after the meeting (**): US$ 90 / ~80 Euro per person

(*) Includes accommodation and full board for the period of the conference and Gala Dinner.
(**) Includes accommodation and full board.
(***) Depending on the resources available, some students might be entitled to receive a partial refund of the registration fee. Eligible registered applicants will be contacted after the early registration deadline. The amount of reimbursement will depend upon available financial resources.

Кушелев: Я бы очень хотел, чтобы Виктория Соколик, богиня пикотехнологии (а теперь ещё и богиня вечной молодости!) сделала доклад на конференции CASP. Ведь после создания пикотехнологии нанотехнология безвозвратно устарела. Это значит, что все, кто сегодня вкладывают в устаревшую нанотехнологию, выбрасывают деньги на ветер, а могли бы вложить в современную пикотехнологию и поднять нашу цивилизацию на новую ступень развития.

Изображение
Подробнее: http://nanoworld.org.ru/topic/1150/
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

  • -1

Сообщение #10 Kushelev » 13.10.2016, 22:06

Вкусная реклама книги "Пикотехнология белков"

Рецензенты:

д.ф.-м.н. ШУЛЬГА Сергей Михайлович;
д.б.н. БОЖОК Галина Анатольевна

Соколик В.В., Кушелев А.Ю.
С 54 Геометрия живого наномира. Пикотехнология белков / В.В. Соколик, А.Ю. Кушелев. – Харьков: Издательство, 2015. – 255 с.
ISBN 978-3-659-92862-8
Монография посвящена 3D-структуре молекул и полимеров живых систем. Дан анализ современного понимания таких фундаментальных понятий, как физический объём атома, химическая связь, генетический код. На основе статистического анализа экспериментальных данных о структуре белка обосновано кодирование его вторичной структуры и структурного полипептидного шаблона в геноме. Предложена дополненная таблица генетического кода белков и пептидов, которая легла в основу геометрического алгоритма программ декодирования структурного шаблона белка Molecular Constructor и Picotech. Сформулирована гипотеза о перекодировании информации третьего нуклеотида кодона в соответствующий ротамер пептидной связи непосредственно 3D-структурой изоакцепторной тРНК. Математический анализ сопряженности значений углов φ и ψ (карта Рамачандрана) выявил периодичность их изменения, что позволило обосновать механизм посттрансляционного фолдинга белка.
Книга рассчитана на специалистов, занимающихся исследованиями в области молекулярной биологии, биоинформатики, биохимии, биофизики.
Табл.: 36 . Ил.:117 . Библиогр.: 227 назв.


Sokolik VV, Kushelev AY
Geometry live nanoworld. Pikotechnology proteins / VV Sokolik, AY Kushelev. - Kharkov: Publishing, 2015. – 255 p.
ISBN 978-3-659-92862-8
The monograph is devoted to the 3D-structure of molecules and polymers in living systems. The analysis of the modern understanding of the fundamental concepts of the physical volume of the atom, chemical bonding, and the genetic code is presented. Based on statistical analysis of the experimental data on the protein structure is justified coding secondary structure and structural polypeptide template of protein in the genome. Propose additions table of the genetic code of proteins and peptides, which formed the basis of the geometric algorithm software decoding structural template protein, are Molecular Constructor and Picotex. The hypothesis of recoding information to third nucleotide codon in the corresponding peptide bond rotamer directly 3D-structure isoacceptors tRNA is formulated. Mathematical analysis of contingency angles φ and ψ (Ramachandran map) revealed their frequency changes as possible to substantiate the mechanism of post-translational protein folding.
The book is intended for professionals involved in research in the field of molecular biology, bioinformatics, biochemistry and biophysics.
Table: 36. Ill: 117. Refs: 227 titles.

ПРЕДИСЛОВИЕ РЕЦЕНЗЕНТОВ
В 21-м столетии в задаче моделирования нанообъектов таких как атом углерода, органические молекулы, пары комплементарных нуклеотидов и многих других используется кольцегранная модель строения атома. В монографии В.В. Соколик и А.Ю. Кушелева «Геометрия живого наномира. Пикотехнология белков» при помощи кольцегранного подхода к строению атома наглядно (образ – модель) реализуются различные виды, свойства и особенности межатомных взаимодействий, валентные углы в молекулах, разновидности химических связей и их соотношение. Кольцегранная модель реалистично объясняет гибридизацию электронов при формировании химических связей в молекулах, что является краеугольным камнем всей биохимии белкового мира, поскольку атомы углерода в состоянии sp3-гибридизации своих электронов входят в состав скелета аминокислот и таким способом детерминируют углы между химическими связями в их молекулах, а в последующем и в структуре белка в целом.
В монографии В.В. Соколик и А.Ю. Кушелева «Геометрия живого наномира. Пикотехнология белков» сформулирована идея композиционного генетического кода, кодирования ротамерии пептидной связи и структурного шаблона белка. Показано, что в геноме третьим нуклеотидом кодона детерминирован один из трёх ротамерных вариантов пептидной связи, которым аминокислотный остаток (закодированный дуплетом первых двух нуклеотидом кодона) присоединяется к растущей полипептидной цепи. Ротамерный вариант пептидной связи реализуется в процессе синтеза белка в рибосоме и поэтому с неё сходит индивидуальный структурный шаблон белка в соответствие с информацией, содержащейся в его гене. Данный механизм трансляции генетической информации является эволюционно новым. Его формирование у эукариот было обусловлено необходимостью синтеза больших и сложных белков в виде структурного шаблона, максимально приближенного к функциональной конформации этих белков, чтобы их фолдинг имел наибольшие эффективность и однозначность. У прокариот и органелл эукариот третий нуклеотид кодонов в генах небольших полипептидов ещё не является информационным, поэтому на нём и наблюдается воблирование.
Выше изложенные положения легли в основу алгоритма авторских компьютерных программ, которые по нуклеотидной последовательности мРНК позволяют смоделировать схему вторичной структуры и 3D-структуру индивидуального структурного шаблон любого белка. Эту первичную информацию о белке можно использовать в дальнейшем моделировании фолдинга функциональной конформации белка с учетом физ-химии его микроокружения, посттрансляционных модификаций, взаимодействия с лигандами методами молекулярной динамики и доккинга наравне с информацией о наиболее стабильном конформере, которую извлекают из рентгенограмм кристаллов белков. Преимущество данного подхода состоит в возможности быстрого моделирования индивидуальной пространственной структуры отдельной молекулы любого белка с точностью до электрона (пикотехнология), опираясь лишь на информацию о нём в геноме. То есть in silico воспроизводится трансляция генетической информации в индивидуальный структурный шаблон белка. Не исключено, что большинство белков именно из конформации своего структурного шаблона максимально быстро, а главное однозначно, фолдируют в нативную конформацию с минимумом свободной энергии, формиру таким образом «устойчивое большинство» конформационно лабильного белкового пула.
Авторами монографии предложен современный, точный и удобный методологический подход в арсенале молекулярной биологии для моделирования пространственной структуры белков, исходя из той информации генома о них, которой располагает сама клетка.
Итак, перед читателем книга, вводящая в мир идей и результатов, ориентированных на применение в протеомике кольцегранной модели и молекулярный полиморфизм, основанный на структурном разнообразии биомакромолекул. В этой области причудливым и невероятным образом пересекаются достижения многих областей современной науки: физики и химии, биологии и медицины, математики и информатики.

Доктор физико-математических наук С.М. Шульга

В настоящее время моделирование пептидов и белков относится к современным и востребованным методическим подходам, позволяющим не только дополнять, но и порой с успехом заменять условно гуманные эксперименты на лабораторных животных, касающиеся взаимодействия различных биогенных соединений с клеточными структурами. К сожалению, данными подходами владеют немногие естествоиспытатели, успешно работающие в своих областях наук. И в этом случае монография В.В. Соколик и А.Ю. Кушелева «Геометрия живого наномира. Пикотехнология белков» позволяет если не овладеть, то, по крайней мере, понять суть применяемых авторами методов построения моделей белков и их кодирования в геноме. Тем более, что книга очень увлекательно и доступно написана. Достигается эта легкость понимания материала тем, что в монографии четко прослеживается научная логика рассуждений и методических подходов авторов. Читателя знакомят с развитием теории строения атома, как с традиционными уже исторически устоявшимися сведениями, так и с новыми интерпретациями кольцегранной структуры атома и аппроксимации геометрии кольцегранной электронной оболочки архимедовыми телами. Авторы пользуются новой «системой координат», их пикотехнология – это технология электронного уровня, разрешение и точность которой сопоставимы с толщиной закольцованного луча-электрона (пикометр – 10-12 м) в атомах белка. Именно этот подход лежит в основе разработанного авторами геометрического алгоритма определения атомного радиуса.

Одним из важнейших итогов материала монографии В.В. Соколик и А.Ю. Кушелева является реальная возможность с помощью законов геометрии макромира рассчитывать положения атомов в молекуле, не прибегая к квантово-механическим функциям. Такие перспективы обеспечиваются ещё и закономерностями формообразования молекул, которые определены структурой внешних кольцегранных оболочек их атомов, которая, как показано авторами, типична для элементов каждой группы таблицы Менделеева. Сопоставление в монографии экспериментальных данных с представленными моделями протеиногенных аминокислот, рассчитанными геометрическим способом для шаблона многогранных моделей аминокислот, аргументирует убедительность и логичность методологии авторов. Кроме моделей самих аминокислот авторы уточняют способ объединения их в полипептидах, возможность формирования трех видов ротамеров пептидной связи (R, 0 или L-ротамеров), которые интерпретируются авторами в качестве прототипов соответствующих конформеров вторичной структуры в белках.
Через призму теории формирования внешней электронной кольцегранной оболочки атома авторы рассматривают последовательно весь геометрический процесс построения пептидов – от пространственной структуры аминокислот до вторичной конформации и этапов фолдинга белковой молекулы. Логичным фрагментом исследований, изложенных в монографии, является объяснение способа и механизма кодирования и декодирования информации о структурном шаблоне белка в геноме.
Детально охарактеризованы декодированные в программах Molecular Constructor и Picotech В.В. Соколик и А.Ю. Кушелева структурные шаблоны белков в качестве субъектов последующего фолдинга. Представлен количественный сравнительный анализ декодированных структур с соответствующими экспериментальными моделями из базы данных PDB. Особое внимание уделено способам описания пространственной структуры белка и характеристике элементов вторичной структуры, а также современным методам моделирования in silico.
Следует отметить, что данная монография актуальна не только как научный труд. Собственный интерес авторов к своей работе заражает, более чем полный массивный объем информации, увлекательная и яркая форма ее изложения и оформления делает монографию применимой также и в качестве учебника для студентов естественнонаучных специальностей, особенно таких, как биохимия, биофизика и биотехнология.

Доктор биологических наук Г.А.Божок


Вкусная реклама книги "Пикотехнология белков"

"Запретный плод сладок", поэтому самой вкусной рекламой книги "Пикотехнология белков" является секретное приложение "100 белковых структур", которые были определены мною с помощью программы "Пикотех" всего за один рабочий день. А в книге "Пикотехнология белков" как раз и объясняется, как создавалась программа, какие идеи легли в её основу...

Книга "Пикотехнология белков". Ссылка доступна за 6 USD
Приложение 1 ****** (открывается вместе со ссылкой на книгу)
Прилложение 2 ******
Приложение 3 ******
Приложение 4 ******
Приложение 5 находится в тексте книги
Приложение 6 находится в тексте книги
Приложение 7 https://yadi.sk/i/ZeW0a6y4hqKVp
Приложение 8 100 структур в формате PDB, PNG ... https://yadi.sk/d/nWEkBJRdhpP4D

Это те самые 100 структур:

Изображение

Вы можете претендовать на 426-ой электронный экземпляр книги.
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

  • -1

Сообщение #11 Kushelev » 06.11.2016, 11:08

Формы, механизмы, энергия наномира. Сообщение 81 745

Zoldrax писал(а):Волна - пилот. Распределение веоятности.
http://youtu.be/1-_IRbu1gAo
Волновая модель кольцевого электрона.
http://youtu.be/kpa_HO6yy18

Кушелев: Классно! Ещё немного, и теоретики смогут адекватно объяснить результаты экспериментаторов: http://subscribe.ru/archive/science.news.nanoworldnews/201507/25214532.html

Изображение

После этого для них будет неожиданным открытием эта тема: http://nanoworld88.narod.ru/data/104.htm

Изображение
А дальше события будут развиваться по той же схеме, что с Emdrive: http://nanoworld88.narod.ru/data/404.htm

Изображение
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

  • -1

Сообщение #12 Kushelev » 16.11.2016, 11:42

Принцип движения НЛО (Денис)

Денис писал(а):Темные пятна во 2,3,4 строках соответствуют атомам меди поверх железа, а не электронным оболочкам одного единственного атома, как вы пытались представить.

Кушелев: Атомам меди соответствуют не тёмные пятна, а кольца, т.е. внешние электроны атомов меди.

Изображение

Валентный электрон имеет размер атома. Его и видно на изображении в виде кольца.

Вот масштабная модель атома с внешней электронной оболочкой, состоящей из двух электронов:

Изображение
Иллюстрация из книги Кеннета Снельсона "Силы становятся видимыми".
Подробнее: http://nanoworld88.narod.ru/data/170.htm
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

  • -1

Сообщение #13 Kushelev » 23.11.2016, 01:07

Формы, механизмы, энергия наномира. Сообщение 82 245

Анатолий Шестопалов писал(а):Александр Юрьевич, в Ответе Черепанова А.И. Шестопалову есть места и про Кушелева, особенно в части толкования экспериментального подтверждения. Мне пока не охота править его формулы, если что будет принципиальное, то я выложу скриншот нужной части письма

Изображение Черепанов Алексей Иванович

Изображение

Цитата
Своим письмом и устно при встрече Вы пытались убедить меня в том, что Канарёв Ф.М. не первый в своих открытиях…
Конец цитаты

Вы мне приписываете то что я не делал. Я не пытался обсуждать с Вами открытия Канарёва Ф.М. и какой он по счету в своих открытиях. Может он еще и варенье варить умеет ... Какое мне дело до этого? Я имею претензии только к "кольцегранным моделям", которые использует Канарёв Ф.М. и Вы называете их моделями Канарёва.
Он мне отказался объяснить чем отличаются геометрически (визуально) якобы его модели водорода от известных с 1915г. моделей водорода, в настоящее время называемых "кольцегранными моделями Кушелева", имея ввиду всех кто был до Кушелева (Кушелев А.Ю. ссылается на предшественников)
http://img-fotki.yandex.ru/get/4523/31556098.9f/0_63de0_932c9847_orig.jpg - атом водорода Канарёва Ф.М.
http://img-fotki.yandex.ru/get/4713/31556098.9f/0_63de4_7ee3594d_L.jpg - атом водорода Огжевальского З.И.
http://img-fotki.yandex.ru/get/4523/31556098.9f/0_63de1_c6a2451f_L.jpg - молекула водорода Канарёва Ф.М.
http://img-fotki.yandex.ru/get/4712/31556098.a0/0_63ded_bf44c96e_L.jpg - молекула водорода Огжевальского З.И.
Если Вы не видите что это одно и тоже, то продолжайте писать что это модели Канарёва! Только не пишите что это ответ на письмо Шестопалова. Я не хочу чтобы Яндекс и Гугл по моей фамилии находили то что Вы написали ниже.

С уважением, Шестопалов А.В.

Добавлено спустя 28 секунд:
Вторник, 22 ноября 2016, 20:43 +03:00 от Original Water Technology <owt2012@mail.ru>:

Мой ответ Шестопалову Анатолию Васильевичу 22 ноября 2016 года


Письмо от Шестопалова Анатолия Васильевича 21 ноября 2016 года

Здравствуйте, Алексей Иванович!

Хронология (история) кольцегранных моделей атомов
http://www.nanoworld.org.ru/data/20061011/20070419/104.htm (рассылка Кушелева А.Ю. на Subscribe_RU, Вып. 104)

1915г. Альфред Парсон (Flfred Parson) из книги Кеннета Снельсона кольцегранная модель атома
http://img-fotki.yandex.ru/get/4603/nanoworld.1f4/0_43da6_64037b03_orig.jpg

1951г. Карл Швайгер (Karl Schwaiger) - патент http://nanoworld.org.ru/post/14600/#p14600

1956г. Огжевальский З.И. "Пространственные модели атомов, молекул и кристаллов" (рукопись монографии 1972г.)
http://www.nanoworld.org.ru/data/20061011/20070415/index.htm
http://barodinamika.livejournal.com/114942.html - фото Збигнева Огжевальского (Огрзевальского)
http://nanoworld.org.ru/post/14604/#p14604 - фото Збигнева Огжевальского (Огрзевальского)
http://nanoworld.org.ru/data/20061011/20070415/103.htm - рассылка на SubscribeRU Вып.103 Кушелева А.Ю.
http://my.mail.ru/mail/gopri/video/89/577.html - Дидык Александр Юрьевич об Огжевальском З.И.

1960г. Кенет Снельсон (США)
http://my.mail.ru/mail/gopri/video/89/323.html - анимация модели атома с сайта
http://kennethsnelson.net/ - сайт
http://kennethsnelson.net/the-atom/ - модели атомов
http://kennethsnelson.net/KennethSnelson_Art_And_Ideas.pdf - монография см. стр. 107-145
http://www.shestopalov.org/data/sh/gazeta.htm - статья в газете
http://nanoworld.org.ru/data/20061011/20070415/233.jpg - фото
https://yadi.sk/i/EhSh1Qp-ecYRn - переписка с учеными о модели атома Снельсона 1962-1981, в т.ч. стр.13-14 с Ричардом Фейнманом (единственный кого я знаю) - отзыв отрицательный.

Добавлено спустя 46 секунд:
1969г. Протодьяконов Михаил Михайлович (младший) http://barodinamika.ru/other/mw_protodiakonov.htm
http://my.mail.ru/mail/gopri/video/89/905.html - Рыков Анатолий Васильевич о Протодьяконове М.М.
http://my.mail.ru/mail/gopri/video/89/904.html - Бобин Вячеслав Александрович о Протодьяконове М.М.
http://my.mail.ru/mail/gopri/video/89/826.html - Иофис Моисей Абрамович о Протодьяконове М.М.

1988г. Кушелев Александр Юрьевич и Кожевников Дмитрий Николаевич (канд.педагог.наук)
http://my.mail.ru/mail/gopri/video/89/776.html - модель атома гелия
http://www.nanoworld.org.ru/data/01/data/images/pictures/geometry/index.htm - модели на сайте Кушелева А.Ю.
http://nanoworld.org.ru/data/01/data/images/slides/20001217/034.jpg - конструктор Кожевникова для школ
http://img-fotki.yandex.ru/get/5812/126580004.7/0_aaaf4_9fd81ee2_orig.jpg - таблицы Кожевникова для школ
Публикации о моделях атома Кушелева А.Ю.:
Малкин Ф. Кудрявый икосаэдр. // Техника молодежи, 1990, N11. - с.60-61
http://img-fotki.yandex.ru/get/5404/nanoworld.1f2/0_42557_ac3ee27d_orig.jpg - обложка
http://img-fotki.yandex.ru/get/5401/nanoworld.1f2/0_42552_400c25cf_orig.jpg - стр.60
http://img-fotki.yandex.ru/get/4804/nanoworld.1f2/0_42553_ae236ef0_orig.jpg - стр.61
http://www.nanoworld.org.ru/data/01/data/texts.rus/9960231.htm
Малкин Ф. Фонд новаторов. // Техника молодежи, 1990, N1. - с.7
http://www.nanoworld.org.ru/data/01/data/texts.rus/9960231.htm

Добавлено спустя 33 секунды:
Nano-world. The Power Engineering of the Future. // Soviet Land, 1991, vol.44, N1. - c.8-9.
http://img-fotki.yandex.ru/get/4804/nanoworld.1f2/0_4259e_1ad0c12f_orig.jpg - обложка
http://img-fotki.yandex.ru/get/5402/nanoworld.1f2/0_4259f_b7aef156_orig.jpg - содержание
http://img-fotki.yandex.ru/get/3611/nanoworld.10e/0_2e32e_d0fe8376_orig.jpg - стр.8
http://img-fotki.yandex.ru/get/5400/nanoworld.1f2/0_4259d_9f838db9_orig.jpg - стр.9
Никонов А. Прошу к столу! Вскипело, или О пользе "чайников". // Огонек, 1995, N29. - с.80-81.
http://img-fotki.yandex.ru/get/24/nanoworld.10/0_a572_c5caac60_orig.jpg - стр.80
http://img-fotki.yandex.ru/get/16/nanoworld.10/0_a574_237d1bea_orig.jpg - cтр.81
Кушелев А.Ю., Полищук С.Е., Неделько Е.В., Кожевников Д.Н., Писаржевский С.А. Экологически чистые микроволновые источники энергии. // "Актуальные проблемы современной науки". - 2001, N2. - с.152–156.
http://fotki.yandex.ru/users/rfcrurfcru/album/106704/
Кушелев А., Полищук С., Писаржевский С. Формы, механизмы, энергия наномира. Доступна ли энергия эфира для космических полетов? // "Электроника: наука, технология, бизнес", 2002, N6. - с.72-76.
http://www.electronics.ru/journal/2002/6
http://www.electronics.ru/journal/article/1393
http://www.electronics.ru/files/article_pdf/1/article_1393_448.pdf
http://www.nanoworld.org.ru/data/05/20021205/index.htm
http://www.nanoworld.org.ru/data/05/20021203/index.htm
Слюсар В. Наноантенны: подходы и перспективы. // "Электроника: наука, технология, бизнес", 2009, N2. - с.58-65.
http://www.electronics.ru/journal/2009/2
http://www.electronics.ru/journal/article/178
http://www.electronics.ru/files/article_pdf/0/article_178_132.pdf

Добавлено спустя 32 секунды:
Кожевников Д.Н. Использование моделирования в обучении в контексте понимания и усвоения категории сложности. // Вестник Московского университета. Серия 20. Педагогическое образование. - 2015, N3 (июль-сентябрь). - с.21-34. -
http://nanoworld.org.ru/post/58978/#p58978
https://yadi.sk/d/kugacsZFi5LKa
Кожевников Д.Н. От моделей обучения к моделям усвоения. // Вестник Московского университета. Серия 20. Педагогическое образование, 2013, N4. - с.50-60. -
http://nanoworld.org.ru/post/58980/#p58980
https://yadi.sk/d/kugacsZFi5LKa
http://www.nanoworld.org.ru/data/20051104/20060203/016.htm - канд.диссертация Кожевникова Д.Н. на тему кольцегранный мир
Другие интернетиздания:
Анна Шереметьева. Модели и конструкторы: химия детям. -
http://letidor.ru/article/modelirovanie_i_konstruirovani_122653/
http://nanoworld.org.ru/post/58357/#p58357
Видео о Кушелеве и Кожевникове на ТВ:
http://my.mail.ru/mail/gopri/video/89/1161.html - Технодром
http://my.mail.ru/mail/gopri/video/89/932.html - До 16-ти и старше
Научпоп "Путешествие в наномир" был снят по заказу ТВ но на экран не выпустили:
http://my.mail.ru/mail/gopri/video/89/150.html - Часть 1
http://my.mail.ru/mail/gopri/video/89/151.html - Часть 2

Добавлено спустя 15 секунд:
2012г. школьник из Екатеринбурга http://my.mail.ru/mail/sinergo/video/325/1235.html

????г. Канарёв Ф.М., Мыльников В.В.
http://img-fotki.yandex.ru/get/6208/31556098.b4/0_6c209_d169d5f6_orig.jpg - фото (Мыльников В.В. кандидат экономических наук, доцент, Адыгейский Государственный Университет, г.Майкоп)
http://www.sciteclibrary.ru/rus/avtors/m.html - публикации Мыльникова В.В. на www.sciteclibrary.ru (см. номер п/п 65)

---------------------------------
Сначала были Кушелев А.Ю. и Кожевников Д.Н. и они думали что больше никто это не изобрел. Потом я Кушелеву А.Ю. нашел и показал Протодьяконова М.М. (он раньше работал в моем институте). Потом они вспомнили, что кто-то им говорил что у Ацюковского В.А. есть рукопись кого-то с такими же картинками.
Кушелев А.Ю. и Кожевников Д.Н. дома у Ацюковского когда перефотографировали рукопись монографии Огжевальского З.
http://img-fotki.yandex.ru/get/6304/31556098.b5/0_6c9e0_951a43a5_orig.jpg
Так на нашем горизонте появился Огжевальский З.И. Как Кушелев А.Ю. узнал о Снельсоне К. я не помню, но можно его об этом спросить.
Потом я увидел в книге Канарёва Ф.М. картинку похожую на модель атома протия
http://img-fotki.yandex.ru/get/4523/31556098.9f/0_63de0_932c9847_orig.jpg
http://img-fotki.yandex.ru/get/4713/31556098.9f/0_63de4_7ee3594d_L.jpg
рисунок на котором два элипса и точка-ядро между ними
http://img-fotki.yandex.ru/get/4523/31556098.9f/0_63de1_c6a2451f_L.jpg
http://img-fotki.yandex.ru/get/4712/31556098.a0/0_63ded_bf44c96e_L.jpg
Я написал ему письмо прокомментировать модели Кушелева, но он ответил что ему нет необходимости ходить по присланным мною ссылкам так как у него все уже разработано и нужно не спрашивать, а брать и изучать его "Физику микромира".

http://www.nanoworld.org.ru/data/01/data/images/pictures/geometry/m8_18_32.jpg - Кольцегранники и многогранники (Кушелев А.Ю.)
Из Кушелев А.Ю. "Энциклопедия Наномир" (электронное издание)
http://www.nanoworld.org.ru/data/20061011/20070419/039.jpg - модели Огжевальского, Снельсона, Кушелева-Кожевникова
http://img-fotki.yandex.ru/get/4419/126580004.16/0_acbc7_a315546b_-1-orig.jpg - модели Огжевальского, Снельсона, Кушелева-Кожевникова (с фотографией Огжевальского З.И.)
https://img-fotki.yandex.ru/get/52446/158289418.30f/0_15c915_cf922f71_orig.jpg - модели электронных оболочек
http://img-fotki.yandex.ru/get/5104/rfcrurfcru.3f/0_48fac_ce5dbf3c_orig.jpg - Обложка энциклопедии Наномир: Кушелев и Кожевников с книгой Снельсона The Nature of Structure
http://nanoworld.org.ru/data/20041130/20060112/009.files/037.jpg - обложка Энциклопедии Наномир Кушелева А.Ю.

=====================================
В настоящее время кольцегранные атомы обнаружены с помощью атомного силового микроскопа!
http://nanoworld88.narod.ru/data/493.htm - рассылка Кушелева Вып 493

ПРИМЕЧАНИЕ
Боевики РАН (боРАНы) постоянно ломают интернет ресурсы Кушелева А.Ю. поэтому оригинальные выпуски рассылок на Subscribe.ru остались без рисунков ... Кушелев восстановил все свои рассылки на www.narod.ru, поэтому я даю ссылки на копии рассылок.

С уважением, Шестопалов Анатолий Васильевич.


Мой ответ Шестопалову Анатолию Васильевичу 21 ноября 2016 года



Уважаемый, Анатолий Васильевич !



Своим письмом и устно при встрече Вы пытались убедить меня в том, что Канарёв Ф.М. не первый в своих открытиях…

Вы привели работы Огжевальского, Снельсона, Кушелева…

В чём глобальная пропасть между тем, что сделал Канарев, и между тем что сделали вышеназванные исследователи ?

1. Глобальное расхождение в методологии данного вопроса. Именно последовательное «движение вперёд», правильно организованное методологически позволило Канареву открыть нам структуру фотона, электрона, протона и нейтрона. Всё это было подкреплено и математикой и освещением различных направлений физики и разбором известных явлений и экспериментов. Напомню, что первое что сделал Канарёв это то, что он поправил Даламбера и Ньютона. Он открыл нам новую «механодинамику»… А дальше шаг за шагом стал разворачивать перед нами свои логические построения и доказательства…

2. Глобальное отличие состоит и в том, что все перечисленные исследователи пытались соединить «несоединимое» - они пытались «улучшить» планетарную модель атома, они пытались опереться на «квантовую физику» и при этом пытались внедрить кольцевую модель электрона. Что из этого получилось Вы можете видеть на фотографиях тех моделей, которые представлены по тем самым ссылкам, которые Вы мне прислали.

И мы прекрасно видим, что модели представленные данными исследователями это всё в угоду планетарной модели атома – см.фото – «Модель электронных уровней .jpg»… У Канарева принципиально всё по-другому ! Поэтому никакого плагиата нет – на что Вы пытаетесь намекать и упрекаете Канарева, что он изобрёл велосипед. Это говорит о том, что Вы не знакомы глубоко ни с атомной физикой, ни с ядерной физикой, ни с квантовой физикой ! Но самый мой главный вывод Вы не знакомы с «физхимией микромира» и Вы не владеете ей…

Скажу более жестче – мало нарисовать «бублик» и сказать – «Вот так выглядит электрон !» Что как будто бы и сделали данные исследователи. Этого явно недостаточно для того чтобы претендовать на роль открывателей ! Для меня как физика было важно другое – Канарев доказал и объяснил почему именно так, а не по-другому… У него доказательная физика ! У него одно вытекает из другого и очень всё стройно построено логически ! У него всё взаимосвязано ! И просто ! Своё повествование Канарев ведёт следующим образом – он выдвигает гипотезу, а затем пишет – «Рассмотрим плодотворность этой гипотезы»… Всё это говорит за то, что Филипп Михайлович создавал «физхимию микромира» методом «проб и ошибок», рождая различные гипотезы и подтверждая плодотворность тех или иных своих догадок… Если бы был плагиат, то легко его обнаружить сравнивая тексты… А сравнивать необходимо тексты , а не рисунки…

Вот один из примеров – выдержка из его книги -

«Эксперименты на ускорителях показали, что криволинейная траектория электрона в магнитном поле хорошо описывается математической моделью, отражающей равенство между центробежной силой инерции, действующей на электрон, и силой магнитного поля.

me•Ve2/R = e • He • Ve (106)

Тут невольно возникает предположение, что процессом формирования кольцевой структуры электрона также управляет этот же закон. Рассмотрим плодотворность этой гипотезы. Поскольку электрон, как мы предполагаем, имеет форму кольца, то для описания процесса формирования кольца надо перевести соотношение (106) в дифференциальную форму. Полагаем, что заряд электрона равномерно распределен по длине его кольцевой модели и каждый элемент кольца ∆l имеет массу ∆m и заряд ∆e (рис. 35).

На каждый элемент кольца будет действовать несколько сил: сила инерции Fi= ∆m• Ve2/ re , кулоновские силы расталкивания, силы магнитного взаимодействия и какие-то другие, пока неизвестные нам силы. Мы будем предполагать, что центростремительная сила, т.е. результирующая сила, искривляющая траекторию отдельных элементов кольца и заставляющая кольцо совершать вращательное движение вокруг оси, будет равна

Fe= ∆e• He• Ve (рис. 35 и формула 107) [1]. Дальнейший анализ, как будет показано, подтвердит плодотворность этого предположения.

∆m • Ve2/ re = ∆e • He• Ve (107)»

Хочу обратить Ваше внимание на то, как изящно доказывает Филипп Михайлович отсутствие орбитального движения электрона –

«Энергия связи E1 электрона атома водорода с протоном в момент пребывания его на первом энергетическом уровне равна энергии ионизации Ei, то есть E1 = Ei = 13,60 eV . Когда электрон поглощает фотон с энергией 10,20 eV и переходит на второй энергетический уровень, энергия связи его с ядром уменьшается и становится равной 3,40 eV [1], [2].

13,60 + 10,20 = 3,40 (154)


Чтобы устранить противоречие в формуле (154), было принято соглашение: считать энергию электрона в атоме отрицательной и записывать формулу (154) так [1], [2]

– 13,60 + 10,20 = – 3,40 (155)



Однако, если учесть полную энергию Ee электрона, то

Ee – 13,60 + 10,20 = Ee – 3,40 (156)


Теперь ясно видно, что энергия электрона в атоме - величина положительная, а уравнение (156) отражает изменение только энергий связи электрона при его энергетических переходах, и минусы перед величинами 13,60 и 3,40 означают не отрицательность энергии, а процесс вычитания энергии, расходуемой на связь электрона с протоном. Запишем аналогичные соотношения для перехода электрона с первого на третий и четвертый энергетические уровни.

Ee – 13,60 + 12,09 = Ee – 1,51 (157)

Ee – 13,60 + 12,75 = Ee – 0,85 (158)

Из соотношений (156), (157) и (158) следует закон формирования спектра атома водорода [1], [2]

Ee – Ei + Ef = Ee – E1 / n2 → Ef = Ei – E1 / n2 , (159)

где: Ef=hvf - энергия поглощенного или излученного фотона; Ei - энергия ионизации, равная энергии такого фотона, после поглощения которого электрон теряет связь с ядром и становится свободным; E1 - энергия связи электрона с ядром атома, соответствующая первому энергетическому уровню также равна энергии фотона.
Для атома водорода E1 =Ei = hv1 = hvf . С учетом этого математическая модель (159) может быть записана так [1], [2]

hvf = hvi - hv1/ n2 → vf = vi - v1/ n2 (160)

Мы получили математическую модель закона формирования спектра атома водорода, в которую входят только частоты поглощаемых или излучаемых фотонов, то есть частоты вращения фотонов относительно своих осей. А где же частота вращения электрона вокруг ядра атома? Нет её. В математической модели закона (160) нет и энергии, соответствующей орбитальному движению электрона.
Почти сто лет мы полагали, что электрон в атоме вращается вокруг ядра, как планета вокруг Солнца. Но закон формирования спектра атома водорода (159) отрицает орбитальное движение электрона. Нет в этом законе энергии, соответствующей орбитальному движению электрона, а значит, и нет у него такого движения [1].
Нетрудно заметить, что по мере удаления электрона от ядра атома (156, 157, 158) его энергия связи Eb с ядром изменяется по зависимости [1], [2]

Eb = Ei / n2 = E1 / n2 =13,60/ n2 eV (161)

где n=1,2,3,....- номер энергетического уровня электрона в атоме, главное квантовое число.
Это и есть математическая модель закона изменения энергии связи электрона с ядром любого атома. Величина E1, входящая в это уравнение, - энергия связи любого электрона с ядром атома, соответствующая первому энергетическому уровню. Для электрона атома водорода она равна энергии ионизации Ei, а для электронов других атомов определяется из экспериментальных спектров по специальной методике, которую мы опишем ниже.»


3. Сравните модель алмаза Кушелева (см.фото) и оцените как просто и логично объясняет структуру нейтрона Канарёв рассматривая модель графита, алмаза и углерода-11 (см.фото – «Рисунок 47. (а) Модель ядра графита , Канарев ф.М.», «Рисунок 47. (b) Модель ядра алмаза, Канарев Ф.М.» и «Рисунок 47.(c) Модель ядра углерода-11, Канарев Ф.М.») –

«Углерод считается основой жизни, так как формирует большое количество связей с атомами других химических элементов. Посмотрим на причину такой его активности (рис. 47).

На рис. 47, а показано плоское ядро этого элемента. Тут невольно вспоминается чешуйчатое, плоское строение графита, состоящего из углерода. Такое вещество образуется из атомов углерода, ядра которых имеют плоскую структуру из шести протонов и шести нейтронов. Однако в Природе встречается углерод и с другой - пространственной компоновкой ядра. Механические свойства алмаза (рис. 47, b), который также состоит из углерода, радикально отличаются от механических свойств графита.

Теперь мы видим, что форма ядра углерода определяет свойства вещества, состоящего из атомов этого химического элемента и линейное взаимодействие электронов с протонами ядер усиливает достоверность многих наших постулатов.

На рис. 47, b показана структура другого ядра атома алмаза. У этой структуры 7 нейтронов. Один расположен в центре пространственной системы координат и три пары других нейтронов направлены вдоль трех координатных осей. Вдоль этих же осей к каждому наружному нейтрону присоединен протон. Таким образом, пространственное ядро такого атома углерода - идеальный узел кристаллической решетки. Такая конструкция ядра и обеспечивает прочность кристаллов алмаза.

Экспериментальная ядерная спектроскопия свидетельствует, что 98,90% ядер углерода содержат 6 протонов и 6 нейтронов и лишь 1,10% процента ядер этого элемента имеют лишний нейтрон. Теперь мы видим, что это ядра атомов алмаза (рис. 47, b).

Обратим внимание на предельную симметричность обоих ядер атома углерода. Плоское симметричное ядро принадлежит углероду, формирующему органические соединения (рис. 47, а). Из этого следует также, что силы связи, действующие между частицами этих ядер, примерно одинаковые.

Из второй (рис. 47, b) и третьей (рис. 47, с) структурных схем ядер атома углерода следует, что нейтрон действительно имеет сложное магнитное поле, состоящее из шести магнитных полюсов. Магнитное же поле протона во всех рассмотренных нами случаях остаётся простым, подобным магнитному полю стержневого магнита.»

Нетрудно понять, что исследователи – Кушелев, Огжевальский, Снельсон и др., пытались улучшить планетарную модель атома и пошли по пути описания «электронных оболочек»… Посмотрите на фотографии многочисленных моделей и прочитайте Канарёва и Вы поймете какая «великая пропасть» лежит между тем что придумали данные исследователи и между тем, что доказал и обосновал Ф.М. Канарёв. Для примера приведу три модели – см.фото – «Модель молекулы З. Огжевальского», «Модель молекулы К. Снельсона» и «Модель молекулы A. Кушелева». Ни одна из этих моделей не может ответить нам на простые вопросы – «Каким образом между молекулами осуществляются «электрон-электронная» связь, «электрон-протонная» связь и «протон-протонная связь» ?»

Для того чтобы разобраться о том, что я имею ввиду, внимательно посмотрите на фото – «Модель атома графита с позиции Канарева Ф.М.».

Размер электрона на три порядка меньше расстояния между электронами атома графита… Далее посмотрите фото – «Модель электрон-электронной связи графита»…. А теперь сравните и Вы поймете – нет никакого плагиата, а есть принципиальное расхождение в том, как устроен микромир и это расхождение представляет собой «гигантскую пропасть»…

Таким образом, подвожу итог… Та информация о кольцегранном микромире, которую Вы мне предоставили интересна только в историческом плане… Да, данная информация доказывает и показывает нам как мучились и продолжают мучиться многие физики с «классической физикой» и с планетарной моделью атома… С моей точки зрения Канарева в этом смысле не в чем упрекать – он шёл абсолютно своим путём, шёл последовательно и проделал с моей точки зрения колоссальный труд, гигантский труд – труд, который казалось бы не посилен одному человеку, но он таки сделал это. И ничего кроме слов благодарности к этому человеку у меня нет.

Далее Вы пишите – «В настоящее время кольцегранные атомы обнаружены с помощью атомного силового микроскопа!
[url]http://nanoworld88.narod.ru/data/493.htm»[/url] -

Ссылканастатью ««Subatomic resolution force microscopy reveals internal structure and adsorption sites of small iron clusters» - «Субатомныйанализ силовой микроскопии показывает внутреннюю структуру и центры адсорбции малых кластеров железа»

На первой фотографии исследователи указали размер – 1 нм … Это 10-9 метра. Комментарий к фотографии - АFМ изображение Si (LLL) - (7x7) реконструкция с использованием металлического наконечника, на конце которого был помещен атом СО.


Кушелев: Что же мы видим на этой иллюстрации ? – фото – «Fig 2. Dimers,trimers, and tetramers imaged by STM, AFM, and their calculated adsorption sites.»


Кушелев: Мы видим внешние кольцевые(!) электроны нескольких атомов.


Для того чтобы комментировать ЭТО предлагаю Вам изучить главу из книги Канарева – «Разрешающая способность электронного микроскопа» - файл прикрепил.


Посмотрите фото – «Рис. 70. Модель ядра атома меди (Cu)»


Канарёв -


«Нетрудно видеть, что атом меди будет иметь только один осевой электрон. Два атома, соединившись осевыми электронами, образуют структуру без магнитных полюсов на её концах. Это и есть причина отсутствия магнитных свойств у меди.»


Посмотрите на фото – «Фотография E - Экспериментальное AFM изображение адатома Cu на Cu»


Комментарий к этому фото таков -


«Экспериментальное AFM изображение адатома Cu на Cu (LLL), показывающий кольцевую симметрию, которая вызвана тороидальной плотностью заряда адатома.»


Указан и размер – 500 pm = 0,5 • 10-9 м.


Вот Вам пример неверной интерпретации полученной фотографии… Для того чтобы получить правильный ответ предлагаю взглянуть на «Модель электрон-электронной связи графита» и внимательно посмотреть на «Рис. 70. Модель ядра атома меди (Cu)», где Вы можете увидеть три ядра графита, входящие в состав меди. А теперь необходимо вспомнить, что полученную исследователями картинку формируют фотоны, которые излучают электроны… Поэтому необходимо разбираться с этими фотографиями с позиций «физхимии микромира» и только тогда можно будет понять, что именно изображено на фотографии… Но это точно не «внешние кольцевые электроны нескольких атомов» ! Размер электрона как мы знаем в 100 раз меньше кольца, которое изображено на фото - «Фотография E - Экспериментальное AFM изображение адатома Cu на Cu», и составляет не более 4,8 • 10-12 м…

Изучайте Канарёва Ф.М. и будет Вам счастье.
Черепанов Алексей Иванович.

Кушелев: Диаметр свободного электрона равен 1.7 А. Так что на этих изображениях видны именно внешние кольцевые электроны атомов: http://nanoworld88.narod.ru/data/493_files/0_13756e.jpg
Подробнее: http://nanoworld88.narod.ru/data/493.htm

Черепанов писал(а):Нетрудно понять, что исследователи – Кушелев, Огжевальский, Снельсон и др., пытались улучшить планетарную модель атома

Кушелев: Не нужно приписывать Кушелеву, Огжевальскому и Снельсону то, что они не делали.

Кольцегранная модель атома принципиально отличается от планетарной.

Изображение
Кстати, у Канарева диаметр электрона 4,8 • 10-12 м, а значит межатомный размер в молекуле водорода того же порядка, т.е. не более 10^-11 м (10 пикометров).

Цитата: Согласно опытным данным, межъядерное расстояние в молекуле водорода составляет 0.74Å

Изображение
А это значит, что более правильные диаметры кольцевых электронов не у Канарева, а у Кушелева, Огжевальского и Снельсона :)
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #14 Kushelev » 23.11.2016, 15:00

Формы, механизмы, энергия наномира. Сообщение 82 257

Кушелев: Диаметр свободного электрона равен 1.7 А = 0,17 * 10-9 м.

[quote=Черепанов Алексей Иванович]ГДЕ доказательства этого утверждения ???[/quote]

Кушелев: Сначала я определил радиусы кольцевых электронов из рефрактометрических радиусов ионов кислорода, хлора и фтора (Работа Гольдшмидта 1923г). Позднее эти радиусы удалось уточнить масштабированием белковых молекул. Ведь макромолекулы белка могут иметь гигантские размеры в масштабах микромира. Я подобрал размер кольцевого электрона таким образом, чтобы размеры белковых молекул, определённых экспериментально совпали с кольцегранными моделями в программе PiMol и HyperChem.
Совпадение размеров макромолекул получилось при диаметре кольца-электрона 1.7А.
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #15 Kushelev » 28.12.2016, 17:08

Формы, механизмы, энергия наномира. Сообщение 83 543

Кушелев: Уважаемая Виктория!
Появилась возможность сравнить наши таблицы композиционного генетического кода.

Я нашёл участок белковой молекулы, который по моей таблице является непрерывной спиралью из 76 аминокислотных остатков:

Изображение
Вы писали, что в Вашей таблице без разницы, код "1" или код "4". В таком случае что же за структура получится по Вашему алгоритму? Прямая альфа-спираль длиной 76 аминокислотных остатков или ?
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #16 Kushelev » 30.12.2016, 13:18

Формы, механизмы, энергия наномира. Сообщение 83 639

Пикотехнология белков, ДНК, РНК - 2

Кушелев: Видео, на котором были открыты кольца из 48 аминокислотных остатков белка 3UAO:

Изображение

Одно кольцо (видео): Изображение

Одно кольцо из пептидных групп (видео): Изображение

Изображение

Изображение

Изображение

Такой композиционный код формирует эти кольца:

144443144443144443144443144443144443144443144443

Скрипт Кушелева, который помог открыть кольца, состоящие из 48 аминокислотных остатков в белке 3UAO:

p = #()
angx=#(10,0,0,10,10); angy=#(30,120,30,30,30); angz=#(97,120,-60,80,80)
--dx=#(2,1.5,1.6,2,2); dy=#(0.6,1,0.8,1,0.6); dz=#(-0.45,0,-0.6,-0.15,-0.45)
dx=#(1.5,1,1.6,1.5,1.5); dy=#(0,-2,-1.5,0,0); dz=#(1.2,-1,-1.2,1.2,1.2)
kk=#(1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3)
ao = mesh vertices: #([1.36,1.414,-0.5],[1.36,1.414,0.5],[1.36,-1.414,-0.5],
[1.36,-1.414,0.5],[0.3599,-1.414,0.5],[0.3599,-1.414,-0.5],[1.86,0.7071,-1],
[2.36,0,-0.5],[1.86,-0.7071,-1],[1.36,0,-1.5],[-0.1401,-0.7071,1],
[1.86,0.7071,1],[2.36,0,0.5],[1.86,-0.7071,1],[1.36,0,1.5],[-0.1401,-0.7071,-1],
[-1.347,4.776,1.022],[-0.6401,4.276,1.522],[0.06697,4.776,1.022],[-0.6401,5.276,0.5217],
[-2.054,4.276,0.5217],[-2.054,4.276,-0.4783],[0.7741,4.276,0.5217],
[0.7741,4.276,-0.4783],[-0.6401,4.276,-1.478],[-1.347,4.776,-0.9783],
[-0.6401,5.276,-0.4783],[0.06697,4.776,-0.9783],[-0.6401,0,-1.478],
[-2.054,1.414,-0.4783],[-2.054,1.414,0.5217],[0.7741,1.414,-0.4783],
[0.7741,1.414,0.5217],[-0.6401,0,1.522],[-2.64,1.414,0.5],[-2.64,1.414,-0.5],
[-1.64,-1.414,-0.5],[-1.64,-1.414,0.5],[-2.64,-1.414,0.5],[-2.64,-1.414,-0.5],
[-1.14,-0.7071,-1],[-3.14,0.7071,1],[-2.64,0,1.5],[-3.14,-0.7071,1],
[-3.64,0,0.5],[-1.14,-0.7071,1],[-3.14,0.7071,-1],[-2.64,0,-1.5],
[-3.14,-0.7071,-1],[-3.64,0,-0.5]) \
faces: #([3,4,5],[5,6,3],[7,8,9],[9,10,7],[13,12,14],[15,14,12],[6,5,11],[3,9,4],
[4,9,13],[13,14,4],[9,8,13],[15,11,4],[4,14,15],[11,5,4],[15,12,2],[9,3,6],
[1,7,10],[1,2,12],[12,8,1],[1,8,7],[12,13,8],[17,18,19],[19,20,17],[25,26,27],
[27,28,25],[24,28,23],[28,20,23],[28,27,20],[20,19,23],[17,21,18],[23,19,18],
[26,22,21],[21,20,26],[26,20,27],[21,17,20],[22,26,25],[21,22,30],[30,31,21],
[22,25,29],[29,30,22],[34,18,21],[21,31,34],[33,23,18],[18,34,33],[23,33,24],
[24,33,32],[25,28,24],[32,29,25],[25,24,32],[37,38,39],[39,40,37],[43,42,44],
[45,44,42],[47,48,49],[49,50,47],[45,50,44],[50,40,44],[50,49,40],[40,39,44],
[37,41,38],[44,39,38],[41,40,48],[48,40,49],[41,37,40],[50,45,42],[42,36,50],
[50,36,47],[42,35,36],[38,46,44],[46,43,44],[43,46,34],[11,15,34],[6,16,9],
[9,16,10],[16,29,10],[41,48,29],[43,35,42],[43,31,35],[43,34,31],[34,15,33],
[33,15,2],[10,32,1],[10,29,32],[29,48,30],[48,47,36],[36,30,48],[30,36,31],
[31,36,35],[1,32,33],[33,2,1],[41,46,38],[16,6,11],[11,34,16],[16,34,29],
[29,34,46],[46,41,29]) \
wirecolor: [255,255,255]
rotate ao 80 [1,0,0]
scale ao [0.5,0.5,0.5]
peptide= copy ao
for k = 1 to 46 do(
element = copy ao
attach peptide element; peptide.pivot = [0,0,0]; move peptide [dx[kk[k]],dy[kk[k]],dz[kk[k]]]
rotate peptide angx[kk[k]] [1,0,0]; rotate peptide angy[kk[k]] [0,1,0]; rotate peptide angz[kk[k]] [0,0,1])
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #17 Kushelev » 31.12.2016, 13:38

Формы, механизмы, энергия наномира. Сообщение 83 702

Пикотехнология белков, ДНК, РНК - 2

Кушелев: В настоящее время мы наблюдаем, что три программы (Неделько, Савина и Кушелева) по одной и той же таблице композиционного кода и одному и тому же алгоритму 2D строят разные 3D-структуры.

Это связано в (не)больших отличиях 3D-алгоритмов.

1. Начальное значение углов вращения по осям X,Y,Z
2. Разные сдвиги вдоль X,Y,Z
3. Разные объекты вращения. В одной программе вращается устанавливаемая аминокислота, а в другой - белок, составленный из предыдущих аминокислот. Хотя вряд ли.
4. Разные точки привязки (Pivot point)
5. Разный порядок вращения по осям X,Y,Z
6. Несоответствие реальному процессу сборки белка рибосомой.

Нужно отметить важные моменты. Во-первых объект имеет 6 степеней свободы. Т.е. его можно вращать по трём ортогональным осям и двигать вдоль трёх ортогональных осей. При этом от последовательности вращений и смещений будет зависеть результат.

Во-вторых, нужно досканально разобраться с реальным механизмом трансляции.

Понятно, что взаимная ориентация аминокислотных остатков программируется таблицей композиционного кода, но ...

нужно понять, как конкретно происходит реализация композиционного кода.

В рибосоме первая аминокислота будущего белка всегда установлена одинаково.

Изображение
К сожалению видео и множество других материалов не сохранилось ни на ютубе, ни на яндексе, ни на мэйл.ру. Пока это есть только в архиве лаборатории Наномир, объём которого порядка 8 терабайт. Так что пока посмотрите слайд-фильм пластмассовых моделей в зеркальном исполнении: http://www.nanoworld.org.ru/data/01/data/images/slides/990410/index.htm

Рассмотрим механизм трансляции.

Первая аминокислота (метионин) расположен на начальной позиции:

Изображение
Подробнее: http://www.nanoworld.org.ru/data/01/data/texts.rus/20011202.htm
Модель светлого цвета внизу. Радикал не показан.

Вторая аминокислота (показана синим) присоединяется сверху.

Угол установки задаётся триплетом, а механизм трансляции показан здесь: http://nanoworld88.narod.ru/data/227.htm

ИзображениеИзображение
Видео в инете не сохранилось, так что ждите, когда удастся выложить из архива лаборатории Наномир повторно.

Для правильного моделирования процесса сборки белка нужно понять нюансы механизма трансляции.

тРНК держит аминокислоту АСС-концом через 4 вандерваальсовых связи:

Изображение Изображение

При входе в рибосому тРНК вращается, т.е. это спиральный транспорт. Инозин антикодона тРНК срезает триплет иРНК и продолжает вращаться уже вместе с триплетом иРНК до его стыковки с комплементарным триплетом рибосомы. Таким образом реализуется кодирование композиционного угла.

После остановки тРНК очередная аминокислота оказывается в нужной позиции по отношению к предыдущей. Теперь её нужно присоединить. АСС-конец сдвигается вдоль оси симметрии и вставляет аминокислоту, которая превращается в аминокислотный остаток) в растущую белковую "цепь".

Теперь нужно решить две проблемы.

1. Вернуть срезанный триплет иРНК на место.
2. Переместить установленную аминокислоту в позицию предыдущей.

Учитывая, что установленная аминокислота (теперь уже аминокислотный остаток) могла поворачиваться на разные углы, поставить её в положение предыдущей не так-то просто. Ведь способ перемещения зависит от угла, на который она была повёрнута перед установкой. Поэтому вторая проблема сцеплена с первой.

Возвращая срезанный триплет иРНК на место тРНК поворачивает на место и установленный аминокислотный остаток. А вместе с ним поворачивает и растущую белковую "цепь". Перед этим манипулятор, который держал предыдущий аминокислотный остаток должен быть убран, иначе он будет мешать вращению белковой "цепи".

Когда белковая цепь повёрнута так, что последний аминокислотных остаток вернулся в исходное положение, т.е. в то, которое он занимал по прибытию на АСС-конце тРНК в рибосому, проблема N2 решается однозначно. Однако, нужно разобраться, как в этом случае ориентирован последний остаток относительно предыдущего. Если этот начальный угол будет смоделирован неправильно, то модель белка тоже будет строиться неправильно.

Сначала разберёмся с максимальным углом поворота. Логично на мой взгляд, чтобы максимальный угол поворота приводил к образованию водородной связи в альфа-спирали. Если угол меньше, то образуется водородная связь 310-спирали. Если угол ещё меньше, то образуется пи-спираль, а нулевым углом, вероятно, логично иметь угол бета-спирали. Но это всё нужно ещё проверить и перепроверить...

Далее нужно разобраться с направлением вращения тРНК. Если это правая спираль, то она вращает аминокислоту по часовой стрелке, если смотреть со стороны группы азота аминокислоты "в хвост тРНК". Но если смотреть на предыдущий аминокислотный остаток со стороны последнего, то ... против часотвой стрелки. Теоретически тРНК может обслужить все углы, но на практике обычно тРНК обслуживает одну или две позиции композиционных углов. Например, угол бета-спирали и 310-спирали. Угол пи-спирали и угол бета-спирали. Кстати, это нужно ещё уточнить и перепроверить...

Главное - выяснить, в каком взаимном положении находится последний аминокислотный остаток после реверса тРНК. Дело в том, что независимо от вариабельной петли, которая может задавать начальное положение аминокислоты, после реверса тРНК это положение может быть одинаковым для всех аминокислотных остатков. Ведь во время реверса тРНК положение антикодона уже не имеет значения.

После реверса тРНК последний остаток может быть переведён в положение предпоследнего однозначным перемещением с поворотом.

Если правильно смоделировать эту последовательность перемещений, то мы получим адекватную модель композиционного кодирования, точнее трансляции.

Добавлено спустя 46 секунд:
Формы, механизмы, энергия наномира. Сообщение 83 678

Пикотехнология белков, ДНК, РНК - 2

Кушелев: Анимация в стандарте AVI кольцегранной модели фрагмента белка 3UAO: https://cloud.mail.ru/public/Jac3/pVxCgCz3U

Изображение

Напоминаю, что вероятность случайного образования кольцевой третичной структуры из 48 аминокислотных остатков равна 4^-48 = 10^-29. Примерно такая же вероятность, как вероятность с первой попытки обнаружить иголку в стоге сена размером с Солнце :)

Скрипт Кушелева, по которому построена кольцегранная модель:

p = #()
angx=#(10,0,0,10,10); angy=#(30,120,30,30,30); angz=#(97,120,-60,80,80)
--dx=#(2,1.5,1.6,2,2); dy=#(0.6,1,0.8,1,0.6); dz=#(-0.45,0,-0.6,-0.15,-0.45)
dx=#(1.5,1,1.6,1.5,1.5); dy=#(0,-2,-1.5,0,0); dz=#(1.2,-1,-1.2,1.2,1.2)
kk=#(1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3,1,4,4,4,4,3)
a = #()
b = #()
num = 12
r = 0.99
alfak = 360 / num
for ii = 1 to num do (
alfa = ii * alfak
a[ii] = [r * cos(alfa),r * sin(alfa),0]
if (ii > (num-1)) then b[ii] = [2,num,1] else if (ii > (num-2)) then b[ii] = [1,num-1,num] else b[ii] = [ii+2,ii,ii+1])
m0 = torus radius1:0.9 radius2:0.1 segs:15 sides:5 position:[0,0,0] pivot:[0,0,-1.41] wirecolor:[255,0,0]
m = copy m0 pivot:[0,0,-1.41] wirecolor:[0,0,255]
rotate m 70.54 [1,0,0] --Rx 70.54
m1 = copy m pivot:[0,0,0] wirecolor:[0,0,255]
rotate m1 120 [0,0,1] --Rz 120
m2 = copy m1 pivot:[0,0,0] wirecolor:[0,0,255]
rotate m2 120 [0,0,1] --Rz 120
m3 = copy m2 pivot:[0,0,0] wirecolor:[255,0,0]
m3.pivot = [0,0,0]
rotate m3 60 [0,0,1] --rz 60
m3.pivot = [0,0,-1.41]
rotate m3 180 [0,1,0] --ry 180
m4 = copy m3 pivot:[0,0,0] wirecolor:[255,0,0]
rotate m4 120 [0,0,1] --rz 120
rotate m4 120 [0,0,1] --Rz 120
m5 = copy m4 pivot:[0,0,0] wirecolor:[0,0,255]
rotate m5 -120 [0,0,1] --rz -120
m5.pivot = [0,0,-1.41]
rotate m5 -70.54 [1,0,0] --Rx -70.54
zd1=-1.41
m100 = copy m0 pivot:[0,0,zd1] wirecolor:[0,0,255]
m10 = copy m pivot:[0,0,zd1] wirecolor:[255,0,0]
m11 = copy m1 pivot:[0,0,zd1] wirecolor:[255,0,0]
m12 = copy m2 pivot:[0,0,zd1] wirecolor:[255,0,0]
m13 = copy m3 pivot:[0,0,zd1] wirecolor:[0,0,255]
m14 = copy m4 pivot:[0,0,zd1] wirecolor:[0,0,255]
m15 = copy m5 pivot:[0,0,zd1] wirecolor:[255,0,0]
rotate m100 180 [0,1,0]
rotate m10 180 [0,1,0]
rotate m11 180 [0,1,0]
rotate m12 180 [0,1,0]
rotate m13 180 [0,1,0]
rotate m14 180 [0,1,0]
rotate m15 180 [0,1,0]
rotate m100 180 [1,0,0]
rotate m10 180 [1,0,0]
rotate m11 180 [1,0,0]
rotate m12 180 [1,0,0]
rotate m13 180 [1,0,0]
rotate m14 180 [1,0,0]
rotate m15 180 [1,0,0]
m100.pivot = [0,0,-3.82]
rotate m100 -90 [1,0,0] --Sy
m10.pivot = [0,0,-3.82]
rotate m10 -90 [1,0,0]
m11.pivot = [0,0,-3.82]
rotate m11 -90 [1,0,0]
m12.pivot = [0,0,-3.82]
rotate m12 -90 [1,0,0]
m13.pivot = [0,0,-3.82]
rotate m13 -90 [1,0,0]
m14.pivot = [0,0,-3.82]
rotate m14 -90 [1,0,0]
m15.pivot = [0,0,-3.82]
rotate m15 -90 [1,0,0] --r0 0 -3.82 -90 0 0
m200 = copy m0 pivot:[0,0,zd1] wirecolor:[0,0,255]
m20 = copy m pivot:[0,0,zd1] wirecolor:[0,0,255]
m21 = copy m1 pivot:[0,0,zd1] wirecolor:[0,0,255]
m22 = copy m2 pivot:[0,0,zd1] wirecolor:[0,0,255]
m23 = copy m3 pivot:[0,0,zd1] wirecolor:[255,0,0]
m24 = copy m4 pivot:[0,0,zd1] wirecolor:[255,0,0]
m25 = copy m5 pivot:[0,0,zd1] wirecolor:[0,0,255]
rotate m200 -35.27 [1,0,0]
rotate m20 -35.27 [1,0,0]
rotate m21 -35.27 [1,0,0]
rotate m22 -35.27 [1,0,0]
rotate m23 -35.27 [1,0,0]
rotate m24 -35.27 [1,0,0]
rotate m25 -35.27 [1,0,0]
move m200 [0,0,1.7] --R 0 0 -1.41 -35.27 0 0
move m20 [0,0,1.7]
move m21 [0,0,1.7]
move m22 [0,0,1.7]
move m23 [0,0,1.7]
move m24 [0,0,1.7]
move m25 [0,0,1.7] -- mz1.7
m300 = copy m200 pivot:[0,0,zd1] wirecolor:[0,0,255]
m30 = copy m20 pivot:[0,0,zd1] wirecolor:[255,0,0]
m31 = copy m21 pivot:[0,0,zd1] wirecolor:[255,0,0]
m32 = copy m22 pivot:[0,0,zd1] wirecolor:[255,0,0]
m33 = copy m23 pivot:[0,0,zd1] wirecolor:[0,0,255]
m34 = copy m24 pivot:[0,0,zd1] wirecolor:[0,0,255]
m35 = copy m25 pivot:[0,0,zd1] wirecolor:[255,0,0]
move m300 [0,0,2]
move m30 [0,0,2]
move m31 [0,0,2]
move m32 [0,0,2]
move m33 [0,0,2]
move m34 [0,0,2]
move m35 [0,0,2] --Mz2
m200.pivot = [0,0,-3.82]
m20.pivot = [0,0,-3.82]
m21.pivot = [0,0,-3.82]
m22.pivot = [0,0,-3.82]
m23.pivot = [0,0,-3.82]
m24.pivot = [0,0,-3.82]
m25.pivot = [0,0,-3.82]
m300.pivot = [0,0,-3.82]
m30.pivot = [0,0,-3.82]
m31.pivot = [0,0,-3.82]
m32.pivot = [0,0,-3.82]
m33.pivot = [0,0,-3.82]
m34.pivot = [0,0,-3.82]
m35.pivot = [0,0,-3.82]
rotate m200 -45 [1,0,0]
rotate m20 -45 [1,0,0]
rotate m21 -45 [1,0,0]
rotate m22 -45 [1,0,0]
rotate m23 -45 [1,0,0]
rotate m24 -45 [1,0,0]
rotate m25 -45 [1,0,0]
rotate m300 -45 [1,0,0]
rotate m30 -45 [1,0,0]
rotate m31 -45 [1,0,0]
rotate m32 -45 [1,0,0]
rotate m33 -45 [1,0,0]
rotate m34 -45 [1,0,0]
rotate m35 -45 [1,0,0] -- r 0 0 -3.82 -45 0 0
delete m200
delete m20
delete m25
delete m35
select #(m,m0,m1,m2,m3,m4,m5,m100,m10,m11,m12,m13,m14,m15,m21,m22,m23,m24,m300,m30,m31,m32,m33,m34)
macros.run "Modifier stack" "convert_to_Mesh"
attach m0 m
attach m1 m2
attach m3 m4
attach m5 m100
attach m10 m11
attach m12 m13
attach m14 m15
attach m21 m22
attach m23 m24
attach m300 m30
attach m31 m32
attach m33 m34
attach m0 m1
attach m3 m5
attach m10 m12
attach m14 m21
attach m23 m300
attach m31 m33
attach m0 m3
attach m10 m14
attach m23 m31
attach m0 m10
attach m0 m23
ao = copy m0 pivot:[-1.2,2.0,-4.4] wirecolor:[0,0,255]
delete m0
scale ao [0.85,0.85,0.85]
rotate ao -43 [1,0,0]
rotate ao -90 [0,1,0]
move ao [2.2,-2.5,3.4]
rotate ao 80 [1,0,0]
scale ao [0.5,0.5,0.5]
peptide= copy ao
for k = 1 to 46 do(
element = copy ao
attach peptide element; peptide.pivot = [0,0,0]; move peptide [dx[kk[k]],dy[kk[k]],dz[kk[k]]]
rotate peptide angx[kk[k]] [1,0,0]; rotate peptide angy[kk[k]] [0,1,0]; rotate peptide angz[kk[k]] [0,0,1])
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #18 Kushelev » 01.01.2017, 15:56

Формы, механизмы, энергия наномира. Сообщение 83 728

Пикотехнология белков, ДНК, РНК - 2

Изображение
Анимация: https://cloud.mail.ru/public/FdEi/YfmHVhyBD

Перевод новой тРНК в положение предыдущей происходит с помощью продвижения мРНК на один кодон. При этом предыдущая тРНК автоматически "отваливается", а белковая "цепь" поворачивается на угол альфа-спирали, т.е. на 97-100 градусов перпендикулярно оси симметрии новой тРНК.. Это меньше, чем угол 108 градусов, на который поворачивается мРНК, поэтому антикодон повёрнутой тРНК "отваливается и от кодона мРНК. Во время реверса новая тРНК "отламывает" старую тРНК и от растущей белковой "цепи", вращая белок по другой оси. Этот механизм возник в процессе эволюции композиционного генетического кода, т.е. с появлением универсальных тРНК. До этого каждому триплету соответствовала своя тРНК. В процессе эволюции число типов тРНК сократилось.

Цитата: меет типичную длину от 73 до 93 нуклеотидов и размеры около 5 нм. Конец цитаты.

Изображение
тРНК (общепринятая модель)

Кушелев: И при таких размерах РСА не позволяет определить форму тРНК. РСА не отличает крест от уголка :)

Изображение
тРНК (пикотехнологическая упрощённая модель)

Дальше процесс строительства белковой "цепи" повторяется:

Изображение
https://cloud.mail.ru/public/7oDf/bgujmw8iV

Файл-сцена для 3DS Max: https://cloud.mail.ru/public/AgsT/rumu2D6jf
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #19 Kushelev » 03.01.2017, 14:43

Пикотехнология белков, ДНК, РНК - 2

Kushelev писал(а):Пикотехнология белков, ДНК, РНК - 2

http://www.rcsb.org/pdb/explore/explore.do?structureId=2XL1

http://www.uniprot.org/uniprot/P22702

Изображение

Заявленная структура - одна альфа-спираль.

http://www.ebi.ac.uk/ena/data/view/AAA33610

>ENA|AAA33610|AAA33610.1 Neurospora crassa hypothetical protein
ATGAACGGGCGCCCGTCAGTCTTCACCTCTCAGGATTACCTCTCAGACCATCTGTGGAGA
GCCCTTAACGCATAA

Изображение
Ну что тут скажешь? "И на старуху бывает проруха"
РСА сглючил до такой степени, что "увидел" прямую альфа-спираль во весь белок. Но там нет этой спирали. Есть два коротких спиральных участка, которые, кстати, в базе DPB числятся нераспознанным участком :)

Композиционный код:

1,1,4,1,4,2,1,1,1,3,1,3,1,1,2,1,3,4,1,3,1,3,1,2

3D модель (без радикалов), построенная по этому коду:

Изображение
Видео: https://cloud.mail.ru/public/Fxiw/5zK3ALCBL

PDB-файл, созданный по нуклеотидной последовательности программой CASP (Евгения Неделько): https://cloud.mail.ru/public/CANL/YpbNWYFH3

Музыка сборки этого белка: https://cloud.mail.ru/public/H7iF/s46adMxMT

Модель, которую показывает Hyperchem по PDB-файлу:

Изображение

Изображение

Изображение

Изображение

Изображение

Изображение

Изображение
Видео: https://cloud.mail.ru/public/7bUF/TnkBtLhkk

Изображение
Видео: https://cloud.mail.ru/public/DK4A/shjPimfGm
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #20 Kushelev » 05.01.2017, 11:58

Формы, механизмы, энергия наномира. Сообщение 83 971

Вышел 581-ый выпуск рассылки "Новости лаборатории Наномир"

http://subscribe.ru/catalog/science.news.nanoworldnews

Дайджест:

581 Триумф пикотехнологии
Изображение
Изображение
Изображение
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #21 Kushelev » 07.01.2017, 01:13

Формы, механизмы, энергия наномира. Сообщение 84 088

Пикотехнология белков, ДНК, РНК - 2

Сейчас пытаюсь найти данные о гормоне панкреатической железы свиньи по нуклеотидной последовательности здесь: http://www.ebi.ac.uk/ena/data/sequence/search

Вот, что удалось найти: http://www.ebi.ac.uk/Tools/services/web/blastresult.ebi?jobId=ncbiblast-R20170106-130838-0541-55542527-es&context=nucleotide&analysis=summary

Изображение

http://www.ebi.ac.uk/ebisearch/crossrefsearch.ebi?id=D13761&db=emblrelease_standard&ref=nucleotideSequences

http://www.ebi.ac.uk/ena/data/view/BAA02907

>ENA|BAA02907|BAA02907.1 Gallus gallus (chicken) &apos;pancreatic polypeptide precursor&apos;
ATGCCGCCCCGCTGGGCCTCGCTGCTGCTGCTGGCCTGCAGCCTGCTGCTGCTCGCTGTG
CCCCCCGGCACCGCCGGCCCCTCGCAGCCCACCTACCCCGGGGATGATGCTCCCGTGGAG
GACCTCATCCGCTTCTACAACGACCTCCAGCAGTACCTCAACGTGGTCACGCGGCACCGG
TACGGCCGGCGGTCCAGCAGCCGGGTGCTGTGCGAGGAGCCCATGGGTGCTGCTGGGTGC
TGA

Изображение

Формы, механизмы, энергия наномира. Сообщение 84 098

Виктория Соколик писал(а):Первые 36 а.о. - панкреатический гормон свиньи: http://www.uniprot.org/uniprot/P01300
Аминокислоты с 27 по 62 - панкреатический гормон гвинейской свиньи: http://www.uniprot.org/uniprot/P13083.
Модель: http://www.rcsb.org/pdb/explore/explore.do?structureId=1bba

http://www.uniprot.org/uniprot/P01300

http://www.ebi.ac.uk/ena/data/view/AAG35647

>ENA|AAG35647|AAG35647.1 Sus scrofa (pig) partial panceatic polypeptide
TACCCCGGGGATGACGCCACGCCAGAGCAGATGGCCCAGTACGCGGCTGAGCTCCGCAGA
TACATCAACATGCTGACCAGGCCCAGGTACGGGAAAAGGGACGAAGAAGACCTACTGGAC
TTGAAGTGCAGCTCCTTACATGCAGCTGCCCCAAGGGAGCTCAGCCCAATGGGTGCGTAA

http://www.ebi.ac.uk/ena/data/view/AAA37051

>ENA|AAA37051|AAA37051.1 Cavia porcellus (domestic guinea pig) hypothetical protein
ATGACCGCCACCCGCTGCTGCTTGTGGCTGCTGCTCCTGGGCACTTGCATGGCCCTGCTG
CTTCCGGAAGCCTGGGGAGCCCCCCTGGAGCCTGTGTACCCCGGGGACGACGCGACGCCC
CAGCAGATGGCTCAGTACGCAGCCGAGATGCGCAGATACATCAACATGCTGACTCGGCCC
AGGTACGGGAAGAGCGCCGAGGAGGATGCGCTGGGCTTGCCGGTGTGGCGCCAGTCCCAC
GCGGCTGCCCCGGGTGGGTCCCATCGCCACCCACCTGCCGGGCTCCCTGCAGCTAAAGGG
GGAACAGGGGTGTCTGGCAGCCCTCCGAAGCCATGGGACTGTCTCCCCTGCCGGGCCCAC
TCTCTCCCCTCGCAGAGCTGA

Изображение

http://www.rcsb.org/pdb/explore/explore.do?structureId=1bba

Изображение

ИзображениеИзображениеИзображение

Кушелев: Кстати, профессор Туманян говорил, что спирали антинаправлены, а программа Пикотех показала, что они практически перпердикулярны. Тогда я не понял в чём дело. Теперь понятно, что программа Пикотех Евгения Неделько неправильно отрабатывает углы по варианту "4". Но с помощью гормона панкреатической железы мы как раз и настроим углы 4-го варианта!

Изображение

На примере этого белка хорошо видно, что РСА "не видит" половины вторичной структуры :)

И это в случае маленького белка. А в случае большого РСА часто вообще "не видит" вторичной структуры, поэтому путает тип белков...

Изображение
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #22 Kushelev » 08.01.2017, 17:19

Формы, механизмы, энергия наномира. Сообщение 84 146

Пикотехнология белков, ДНК, РНК - 2

https://ru.wikipedia.org/wiki/Амилаза

Изображение
Salivary alpha-amylase 1SMD
Структура амилазы слюнных желез. Катион кальция показан жёлтым цветом, анион хлора - зелёным.

http://www.rcsb.org/pdb/explore/explore.do?structureId=1SMD

http://www.uniprot.org/uniprot/P04745

http://www.ebi.ac.uk/ena/data/view/BAF85030

>ENA|BAF85030|BAF85030.1 Homo sapiens (human) hypothetical protein
ATGAAGCTCTTTTGGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCTCAAAT
ACACAACAAGGACGAACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCT
CTTGAATGTGAGCGATATTTAGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCA
AATGAAAATGTTGCCATTCACAACCCTTTCAGACCTTGGTGGGAAAGATACCAACCAGTT
AGCTATAAATTATGCACAAGATCTGGAAATGAAGATGAATTTAGAAACATGGTGACTAGA
TGCAACAATGTTGGGGTTCGTATTTATGTGGATGCTGTAATTAATCATATGTGTGGTAAT
GCTGTGAGTGCAGGAACAAGCAGTACCTGTGGAAGTTACTTCAACCCTGGAAGTAGGGAC
TTTCCAGCAGTCCCATATTCTGGATGGGATTTTAATGATGGTAAATGTAAAACTGGAAGT
GGAGATATCGAGAACTATAATGATGCTACTCAGGTCAGAGATTGTCGTCTGTCTGGTCTT
CTCGATCTTGCACTGGGGAAGGATTATGTGCGTTCTAAGATTGCCGAATATATGAACCAT
CTCATTGACATTGGTGTTGCAGGGTTCAGAATTGATGCTTCCAAGCACATGTGGCCTGGA
GACATAAAGGCAATTTTGGACAAACTGCATAATCTAAACAGTAACTGGTTCCCGGAAGGT
AGTAAACCTTTCATTTACCAGGAGGTAATTGATCTGGGTGGTGAGCCAATTAAAAGCAGT
GACTACTTTGGTAATGGCCGGGTGACAGAATTCAAGTATGGTGCAAAACTCGGCACAGTT
ATTCGCAAGTGGAATGGAGAGAAGATGTCTTACTTAAAGAACTGGGGAGAAGGTTGGGGT
TTCATGCCTTCTGACAGAGCGCTTGTCTTTGTGGATAACCATGACAATCAACGAGGACAT
GGCGCTGGAGGAGCCTCTATACTTACCTTCTGGGATGCTAGGCTGTACAAAATGGCAGTT
GGATTTATGCTTGCTCATCCTTATGGATTTACACGAGTAATGTCAAGCTACCGTTGGCCA
AGATATTTTGAAAATGGAAAAGATGTTAATGATTGGGTTGGGCCACCAAATGATAATGGA
GTAACTAAAGAAGTTACTATTAATCCAGACACTACTTGTGGCAATGACTGGGTCTGTGAA
CATCGATGGCGCCAAATAAGGAACATGGTTAATTTCCGCAATGTAGTGGATGGCCAGCCT
TTTACAAACTGGTATGATAATGGGAGCAACCAAGTGGCTTTTGGGAGAGGAAACAGAGGA
TTCATTGTTTTCAACAATGATGACTGGACATTTTCTTTAACTTTGCAAACTGGTCTTCCT
GCTGGCACATACTGTGATGTCATTTCTGGAGATAAAATTAATGGCAACTGCACAGGCATT
AAAATCTACGTTTCTGATGATGGCAAAGCTCATTTTTCTATTAGTAACTCTGCTGAAGAT
CCATTTATTGCAATTCATGCTGAATCTAAATTGTAA

Изображение

Изображение
Структурный (архитектурный) перевертыш на базе программной спирали 21212

Изображение
Структурный (архитектурный) перевертыш

Изображение
Структурный (архитектурный) перевертыш на базе программной спирали 3131313131313

Добавлено спустя 4 часа 35 минут:
Формы, механизмы, энергия наномира. Сообщение 84 151

Готовится 583-ий выпуск рассылки "Новости лаборатории Наномир"

http://subscribe.ru/catalog/science.news.nanoworldnews

Дайджест:

583 Emdrive в СССР зарегистрирован в 1973 году!
Фрактальные программные спирали белков
Непрерывная белковая спираль рекордной длины
Пикотехнологическая модель глюкагона "говорит и показывает"...
Деформированные структурные (архитектурные) перевертыши
ИзображениеИзображение
ИзображениеИзображениеИзображениеИзображение
Изображение
Изображение
Изображение
Изображение
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #23 Kushelev » 12.01.2017, 21:02

Формы, механизмы, энергия наномира. Сообщение 84 389

Пикотехнология белков, ДНК, РНК - 2

Изображение
Кушелев: Все видят корреляцию?

Изображение
Такая корреляция наглядно показывает предсказательную силу пикотехнологии даже на уровне 2D-структуры.

Изображение

Изображение

Изображение

Изображение

Изображение

Кушелев: Корреляция вторичной структуры по таблице композиционного кода с первичной последовательностью белка, в частности, иминокислоты Pro, очевидна.

А первичная последовательность в отличие от данных РСА имеет 100%-ную надёжность :)
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #24 Kushelev » 12.01.2017, 22:09

Формы, механизмы, энергия наномира. Сообщение 84 391

Пикотехнология белков, ДНК, РНК - 2

Кушелев: Уважаемая Виктория!
Предлагаю сравнить величину корреляции вторичной структуры по данным разных методов с первичной структурой, в частности по пролину. И сразу выяснится, "Кто есть Who?" :)

А по результатам сравнения имеет смысл написать научную статью, которая может "взорвать" научный мир :)

Изображение

Очевидно, что корреляция вторичной структуры с первичной по Pro, полученной по программе Пикотех, выше аналогичной корреляции вторичной структуры из PDB.

Изображение
http://www.rcsb.org/pdb/explore/explore.do?structureId=2ND1

Подробнее: http://nanoworld.org.ru/post/82401/#p82401
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #25 Kushelev » 13.01.2017, 21:43

Формы, механизмы, энергия наномира. Сообщение 84 424

Пикотехнология белков, ДНК, РНК - 2

Виктория Соколик писал(а): Очевидно, что в этом случае будет синтезироваться спиральный виток, НО останется ли он после окончательного формирования функциональной конформации белка БОЛЬШОЙ вопрос.

Кушелев: "Ломать не делать". Сломать можно не только молекулу белка, но и белковый кристалл разбить :) Главное, что рибосома формирует заранее известную структуру, альфа-спираль. Именно над этим вопросом бились десятки тысяч молекулярных биологов прошлого века. А мы с Вами точно знаем, что участки белков -Trp-Met-Trp-Met-, -Trp-Trp-Trp-Trp-Trp- или -Met-Met-Met-Met- альфа-спираль однозначно. А что с ней потом сделают, это уже "другая песня".

Поэтому мне хотелось бы, чтобы Вы написали научную статью с изложением этого научного открытия. А заодно можно показать и фрагменты лизоцимов: http://nanoworld.org.ru/post/82424/#p82424

Ведь замыкание дисульфидных мостиков подтвердилось экспериментально, а случайное замыкание по коду имеет ничтожную вероятность.

Изображение
И в случае фрагментов лизоцимов мы на 100% достоверно знаем, что ничего с этими структурами после сборки рибосомой не случается. Дисульфидные мостики не размыкаются.

Виктория Соколик писал(а):Вот Вы надергали примеров из разных белков, а что про эти участки известно в PDB? Oни РЕАЛЬНО выявляются в составе спиральных фрагментов или это опять Ваши благие пожелания?

Кушелев: С этими участками имеет смысл показать статистику в научной статье, а что касается "известно в PDB", то мы уже выяснили, что в случае фрагмента двух разных лизоцимов экспериментальное подтверждение есть. Если для научной статьи нужно больше примеров, то можно их собрать. Но даже двух примеров достаточно, чтобы получить достоверность "сорок девяток", т.е. 99.9999999999999999999999999999999999999%

Виктория Соколик писал(а):
Kushelev писал(а):Если по Вашему алгоритму лизоцим не имеет определённой структуры, то как его фрагмент может замкнуться на уровне композиционного кода?

Вы нарочно всё извращаете, когда говорите о моей программе?
Лизоцим не имеет фрагментов ВТОРИЧНОЙ структуры, но это не отменяет его 3D-структуры в пространстве, которая закодирована и детерминирована в его гене.

Кушелев: Что-то я совсем запутался. Я правильно понял, что фрагмент лизоцима может не иметь вторичной структуры, но иметь третичную?

Но почему мы не может сказать, что он имеет и вторичную структуру, только не альфа- или 310-спиральную, а вот такую, но конкретную:

Изображение
Человеческий лизоцим имеет на (18-4)/18=14/18=78% альфа-310-спиральную вторичную структуру, на 4/18=22% - бета вторичную структуру.

Изображение
Куриный лизоцим имеет на ... ха-ха. Последовательности куриного лизоцима и этого:

Изображение
ИзображениеИзображение

не совпадают! Даже по количеству аминокислотных остатков! На схеме вторичной структуры их 19, а на модели третичной структуры - 22! Ну и последовательность совсем другая. Тут не два, три разных лизоцима :)

Виктория Соколик писал(а):Отлично, мне остаётся только благословить Вас на эту публикацию. Если будет настроение поделитесь на форуме рецензиями, мне очень интересно будет прочитать.

Кушелев: Не, так дело не пойдёт. Кто же, кроме Вас сможет опубликовать правильную научную статью с величайшим научным открытием? Если уж Вы смогли книгу "Пикотехнология белков" написать и опубликовать, то статья у Вас точно "на ура пройдёт" :) А я опять согласен быть соавтором...
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #26 Kushelev » 14.01.2017, 21:20

Формы, механизмы, энергия наномира. Сообщение 84 458

Пикотехнология белков, ДНК, РНК - 2

Kushelev писал(а):N3 Это - лизоцим куриного яйца
http://www.rcsb.org/pdb/explore/explore.do?structureId=132L

http://www.uniprot.org/uniprot/P00698

http://www.ebi.ac.uk/ena/data/view/AAA48943

>ENA|AAA48943|AAA48943.2 Gallus gallus (chicken) hypothetical protein
ATGAGGTCTTTGCTAATCTTGGTGCTTTGCTTCCTGCCCCTGGCTGCTCTGGGGAAAGTC
TTTGGACGATGTGAGCTGGCAGCGGCTATGAAGCGTCACGGACTTGATAACTATCGGGGA
TACAGCCTGGGAAACTGGGTGTGTGCCGCAAAATTCGAGAGTAACTTCAACACCCAGGCT
ACAAACCGTAACACCGATGGGAGTACCGACTACGGAATCCTACAGATCAACAGCCGCTGG
TGGTGCAACGATGGCAGGACCCCAGGCTCCAGGAACCTGTGCAACATCCCGTGCTCAGCC
CTGCTGAGCTCAGACATAACAGCGAGCGTGAACTGCGCGAAGAAGATCGTCAGCGATGGA
AACGGCATGAACGCGTGGGTCGCCTGGCGCAACCGCTGCAAGGGCACCGACGTCCAGGCG
TGGATCAGAGGCTGCCGGCTGTGA

Изображение
Вторичная структура полностью: https://img-fotki.yandex.ru/get/125649/158289418.3b3/0_16f6f6_81595f3_orig.gif
Подробнее: http://nanoworld.org.ru/topic/1530/page/97/

N3 Это - лизоцим куриного яйца (фрагмент 19 ао). Надо его тоже проверить на замыкание в 3D версии пикотех :)

Изображение
Кушелев: Тоже замкнулся через дисульфидный мостик!

Изображение
Но куриный лизоцим замыкается иначе, чем человеческий, т.е. "не по человечески" :)

Изображение
Здесь есть очень существенный момент. В курином лизоциме есть точно такой же фрагмент, как и в человеческом. Но этот короткий замкнутый участок Cys 94 - Cys 98 находится в другом месте. При этом он замыкается только по алгоритму Кушелева, т.е. если спираль на коде "4" гнётся. Если спираль прямая, как утверждает Виктория Соколик, то радикал Cys 98 не может дотянуться до радикала Cys 94, и дисульфидный мостик не может замкнуться. Это позволяет сделать правильный выбор между разными алгоритмами определения пространственной структуры белка.

В общей сложности построены модели 4 замкнутых через дисульфидные мостики участков.

1. Cys 95 - Cys 113 в человеческом лизоциме.
2. Cys 96 - Cys 117 в альтернативном человеческом лизоциме.
3. Cys 78 - Cys 82 в альтернативном человеческом лизоциме.
4. Cys 94 - Cys 98 в лизоциме куриного яйца

Вероятность случайного совпадения результата работы геометрического алгоритма с экспериментальными данными ничтожна. Для каждого участка отдельно она не превышает:

1. 4^-18
2. 4^-21
3. 4^-4
4. 4^-4

Вероятность угадать все 4 участка не превышает 4^-(18+21+4+4)=4^-47 Примерно такая же вероятность случайно нащупать на расстоянии вытянутой руки иголку в стоге сена размером с Солнечную систему.

В процессе моделирования фрагментов лизоцима и др. обнаружилась необходимость учёта 5 вариантов композиции, т.е. настройки 5 вариантов композиционных углов.

1. Код альфа-спирали
2. Код бета-спирали
3. Код пи-спирали
4. Код 310-спирали
5. Одиночный код альфа или 310.
Но это всё равно упрощённый алгоритм, т.к. в белках с Met нужно учитывать шестой вариант. И это только геометрический алгоритм. В будущем нужно учесть физико-химические взаимодействия. Модификация белка после рибосомальной сборки - отдельная "песня".

Добавлено спустя 2 часа 53 минуты:
Формы, механизмы, энергия наномира. Сообщение 84 465

Пикотехнология белков, ДНК, РНК - 2

Skype, 2017-01-15:

[0:11:06] Кушелев Александр Юрьевич: На первом этапе хотелось бы получить следующую версию композиционного кода.

Изображение
Новые варианты композиции показаны красным цветом в правом столбце.

Добавлено спустя 13 часов 43 минуты:
Формы, механизмы, энергия наномира. Сообщение 84 482

Пикотехнология белков, ДНК, РНК - 2

См. Формы, механизмы, энергия наномира. Сообщение 84 458

В общей сложности построены модели 5 замкнутых через дисульфидные мостики участков.

1. Cys 95 - Cys 113 в человеческом лизоциме.
2. Cys 96 - Cys 117 в альтернативном человеческом лизоциме.
3. Cys 78 - Cys 82 в альтернативном человеческом лизоциме.
4. Cys 94 - Cys 98 в лизоциме куриного яйца
5. Met 1 - Cys 13 в мышином лизоциме

Вероятность случайного совпадения результата работы геометрического алгоритма с экспериментальными данными ничтожна. Для каждого участка отдельно она не превышает:

1. 4^-18
2. 4^-21
3. 4^-4
4. 4^-4
5. 4^-12

Вероятность угадать все 5 участков не превышает 4^-(18+21+4+4+12)=4^-59 Примерно такая же вероятность случайно нащупать иголку в стоге сена размером с Солнечную систему, не вынимая руки из кармана.

В процессе моделирования фрагментов лизоцима и др. обнаружилась необходимость учёта 6 вариантов композиции, т.е. настройки 6 вариантов композиционных углов.

1. Код альфа-спирали
2. Код бета-спирали
3. Код пи-спирали
4. Код 310-спирали
5. Одиночный код альфа или 310.
6. Код метионина в составе спирали.
Но это только геометрический алгоритм. В будущем нужно учесть физико-химические взаимодействия. Модификация белка после рибосомальной сборки - отдельная "песня".

Добавлено спустя 4 часа 21 минуту:
Формы, механизмы, энергия наномира. Сообщение 84 488

Пикотехнология белков, ДНК, РНК - 2

Изображение

Обнаружился 6-ой фрагмент, замкнутый через дисульфидный мостик. На этот раз это Met 1 - Cys 24 куриного яйца.

Рекордная длина фрагмента и рекордно малая вероятность случайного замыкания 4^-23 = 1.4*10^-14.

В этом фрагменте встречаются два одиночных кода 310-спирали ("5") и два кода 310-спирали в составе спиралей ("4"). Поэтому старая версия Пикотех даёт ошибку при любой настройке композиционных углов варианта "4". Минимальная ошибка получается в случае правильных углов в составе спирали. Этот вариант и помог обнаружить ещё один дисульфидный мостик куриного лизоцима.

Изображение

Изображение

Изображение

Изображение

Изображение

В общей сложности построены модели 6 замкнутых через дисульфидные мостики участков.

1. Cys 95 - Cys 113 в человеческом лизоциме.
2. Cys 96 - Cys 117 в альтернативном человеческом лизоциме.
3. Cys 78 - Cys 82 в альтернативном человеческом лизоциме.
4. Cys 94 - Cys 98 в лизоциме куриного яйца
5. Met 1 - Cys 13 в мышином лизоциме
6. Met 1 - Cys 24 в лизоциме куриного яйца
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #27 Kushelev » 16.01.2017, 01:23

Пикотехнология белков, ДНК, РНК - 2

Кушелев: Создаём новую версию Пикотехнологии 2D...

Skype, 2017-01-15:

[0:11:06] Кушелев Александр Юрьевич: На первом этапе хотелось бы получить следующую версию композиционного кода. Новые варианты композиции показаны красным цветом в правом столбце:

Изображение
[11:45:58] Кушелев Александр Юрьевич: Конечно, я могу и вручную написать композиционный код 6, но программа сильно сэкономила бы время...
[12:46:46] Va12220(valqwa): не напишешь
[12:46:54] Va12220(valqwa): я вернулся. ты скучал ?
[13:01:39] Кушелев Александр Юрьевич: Ты можешь подправить программу от Prosolver?
[13:10:45] Va12220(valqwa): Это старая версия 2D: http://nanoworld.narod.ru/Pikotech2D_3.6.zip ?
[13:13:06] Кушелев Александр Юрьевич: Возьми новую. Она копирует в буфер обмена данными композиционный код.
[13:13:30] Кушелев Александр Юрьевич: Сможешь сделать, чтобы код был таким, как справа?

Изображение
[13:14:05] Va12220(valqwa): справа - это где красные цифры 5 и 6 ?
[13:14:10] Кушелев Александр Юрьевич: Да
[13:15:08] Кушелев Александр Юрьевич: Цифра 6 связана только с одним кодом Met, т.е. ATG
[13:15:26] Кушелев Александр Юрьевич: А цифра 5 - одиночные коды "1" или "4"
[13:16:26] Кушелев Александр Юрьевич: Если в составе спиралей, то они "1" и "4", а если до витка спирали не дотягивает, то "5"
[13:19:06] Кушелев Александр Юрьевич: На примере лизоцима я обнаружил, что структура белка может быть напряжённой, т.е. по коду 4 атомные группы как бы вдавливаются в соседние. А если был бы код 1, то не вдавливались бы. Но в этом белке нужно получить напряжённое состояние, поэтому код 1 в процессе эволюции заменился на 4.
[13:19:42] Кушелев Александр Юрьевич: Так что без учёта физики некоторые белки мы не сможем правильно построить.
[13:20:01] Кушелев Александр Юрьевич: Только ненапряжённые.
[13:24:57] Va12220(valqwa): пробую разобраться
[13:26:16] Кушелев Александр Юрьевич: Чем быстрее сможем настроить программу, тем быстрее сможем заинтересовать заказчиков. Не настроенная программа отпугивает. Американский заказчик отвалился.
[13:27:14] Кушелев Александр Юрьевич: Там ещё менеджер схалтурил. Я ему говорил, чтобы он предупредил, что программа ещё не отлажена, есть ошибки. А он не передал американцам. И вторичную структуру вообще не показал...
[13:41:55] Va12220(valqwa): ну... ничего про него не скажу.
[13:41:58] Va12220(valqwa): жди немного
[13:55:11] Кушелев Александр Юрьевич: Кстати, если Met не в составе альфа- или 310-спирали, то его код 5.
[14:04:35] Va12220(valqwa): погоди. я запутался. пару шагов обратно:

(я с тобой) мы делали ранее 2 задачи
1 - преобразование .fast (.dne) в композиционный вид (код)
2 - а далее этот комппозитный код "крутили-вертели" и получали .PDB результат. (неплохой кстати), но только остановились на ... структуре.
а ты сейчас предлагаешь старую программу на паскале "исправить"
[15:17:39] Va12220(valqwa): мы работали с такой таблицей
[15:19:33] Va12220(valqwa): согласно этой табилце мы преобразовывали элементы FAST ('aca') в композитный код ('2')
[15:22:23] Va12220(valqwa): получив композитный код (мы это делали на примере кода коллагена), мы строили цепочку (точек, вершин) методом сдвигов и поворотов.
полученную цепочку записывали в файл PDB формата. и далее "смотрели " полученную молекулу в PDB-вьювере.
[17:18:35] Кушелев Александр Юрьевич: Да
[17:21:43] Кушелев Александр Юрьевич: В 3D алгоритме было заложено "альфа-спираль", если коду "1" предшествуют 3 кода "1" или "4" и "310-спираль", если коду "4" предшествуют 2 кода "1" или "4". В противном случае это не код "1" или "4", а код "5"
[17:22:18] Кушелев Александр Юрьевич: В программе от Prosolver это нужно реализовать.
[17:22:45] Кушелев Александр Юрьевич: Т.е. чтобы номера кодов выводились в схему и в буфер обмена данными.
[18:21:30] Va12220(valqwa): понятно. не прочел то что я пишу. все о своем пишешь. того что ты пишешь - недостаточно. пропускаешь полезные моменты.

и так. все преобразования что ты делаешь - они закодированы в первичном варианте таблицей (ту что я тебе скинул).
Таблица сопоставляет тройки (буквенного)кода определенным вариантам преоброзований. До нынешнего момента - это были варианты: 1 2 3 и 4

верно ?
[18:25:02] Кушелев Александр Юрьевич: Да
[18:25:29] Кушелев Александр Юрьевич: Но нам мало таблицы
[18:25:41] Va12220(valqwa): стоп.
[18:26:40] Кушелев Александр Юрьевич: Нам нужно добавить алгоритм. "Если коду "1" предшествуют коды "1" или "4" (не менее 3), то это - код "1". Если менее, то это - код "5"
[18:27:16] Va12220(valqwa): и так - берем фаст код. и получаем (используя таблицу) - кодовую таблицу (вероятных) будущих преобразований.

НО - этого недостаточно.

прежде чем делать будущие преобразования - необходимо полученный кодовый набор обработать.

верно ? что бы учесть варианты спиралей и прочие тонкости структуры
[18:27:31] Кушелев Александр Юрьевич: Да
[18:29:31] Va12220(valqwa): ну слава богу.

значит сл. этап - взять кодовый (цифровой) набор и с ним пработать. сл. образом:
по очереди давай смотреть:

если встретилась цепочка "1 1 1 1" - то она должна быть преобразована в цепочку "1 1 1 6"
[18:29:34] Va12220(valqwa): верно ?
[18:30:45] Va12220(valqwa): у тебя так по картинке выходит
[18:30:48] Кушелев Александр Юрьевич: Нет. Должна остаться 1111, если там нет Met
[18:31:41] Кушелев Александр Юрьевич: Met в окружении "1" или "4" должен из "1" превратиться в "6"
[18:31:59] Va12220(valqwa): т.е. условие более сложное. надо анализировать так же и буквенную последовательность
[18:32:11] Кушелев Александр Юрьевич: Да. Это только для Met
[18:34:03] Кушелев Александр Юрьевич: А коды:
212 -> 252
313 -> 353
2113 -> 1553
[18:34:41] Кушелев Александр Юрьевич: 21142 -> 24442
[18:35:11] Va12220(valqwa): 213 - 253 ?
[18:35:19] Кушелев Александр Юрьевич: Да
[18:35:28] Кушелев Александр Юрьевич: 243 - 253
[18:35:33] Va12220(valqwa): и много таких комбинаций ?
[18:36:07] Кушелев Александр Юрьевич: Прилично
[18:36:12] Кушелев Александр Юрьевич: Под сотню
[18:36:22] Кушелев Александр Юрьевич: Теоретически можно и таблицей задать
[18:37:25] Кушелев Александр Юрьевич: Но можно и логически
[18:38:39] Кушелев Александр Юрьевич: Если встречается менее 3 подряд символов 1 или 4, то они заменяются на 5
[18:39:46] Va12220(valqwa): так или так но надо описать. включая примеры. что бы я мог логику встроить в программу и проверить потом.
[18:40:25] Va12220(valqwa): а преобразования кодам 5 и 6 ты знаешь какие надо применить ?
[18:40:26] Кушелев Александр Юрьевич: Если встречается менее 4 символов подряд 1 или 4 (последний "1"), то они заменяются на 4
[18:40:44] Кушелев Александр Юрьевич: Да. Углы другие
[18:42:17] Кушелев Александр Юрьевич: Сначала нужно заменить 1 на 4, если 1 или 4 подряд меньше 4. А потом заменить 4 на 5, если подряд меньше 3
[18:42:36] Va12220(valqwa): вот смотри - ты пишешь:
[18:40] Кушелев Александр Юрьевич:

<<< Если встречается менее 4 символов подряд 1 или 4 (последний "1"), то они заменяются на 4
это обозначаем - 1 2 или 3 символа, последний 1 - я так понимаю - это все же 2 или 3 символа

пиши примеры
[18:44:16] Va12220(valqwa): и ещё вопрос.
в наборе 1-3-4-4-2-1-3 попалась цепочка из 3х символов - например 1-3-4 я её меняю на 1-3-5
далее я начинаю рассматривать сл варианты из этой последовательности 3-4-4 - её я должен поменять на 3-4-5

НО при этом я уже ранее поменял среднюю 4 на 5
[18:46:12] Кушелев Александр Юрьевич: 111->555
411->555
141->555
441->555
114->444
144->444
414->444
444->444
[18:46:43] Кушелев Александр Юрьевич: 1114->1444
[18:47:21] Кушелев Александр Юрьевич: 1141->4441
[18:47:37] Кушелев Александр Юрьевич: Похоже, что придётся таблицу составлять. Там не всё так просто
[18:48:01] Va12220(valqwa): ну вот слава богу - дошло до тебя. )
[18:49:36] Va12220(valqwa): пока ты будешь выводить правило замены - я закончу то что не доделал почти год тому. программу "савина-неделько"
[18:49:39] Кушелев Александр Юрьевич: Тут придётся повторять логику рибосомы.
[18:50:10] Кушелев Александр Юрьевич: Рибосома ставит аминокислоты по очереди.
[18:50:32] Va12220(valqwa): мне это не знакомо так как тебе. извини. не помогу
[18:50:33] Кушелев Александр Юрьевич: Если она ставит по варианту 2 или 3, то ничего менять не нужно
[18:51:25] Va12220(valqwa): у вас там есть где парковаться у дома ?
[18:51:30] Кушелев Александр Юрьевич: Если она ставит по варианту 4, то нужно проверить предыдущие 2. Если все они 1 или 4, то вариант 4 остаётся. Если нет, то превращается в вариант 5.
[18:51:36] Кушелев Александр Юрьевич: Есть
[18:51:48] Va12220(valqwa): )) и дворники чистят дороги ?
[18:52:11] Кушелев Александр Юрьевич: Но если следующий вариант будет 1 или 4, то предыдущий вариант 5 нужно будет вернуть на место :)
[18:52:17] Кушелев Александр Юрьевич: Вроде чистят
[18:53:01] Кушелев Александр Юрьевич: Короче, с логикой рибосомы придётся ещё разобраться...
[18:53:17] Va12220(valqwa): хооршо. описывай логику. и делай описание в примерах
т.е. так:
[18:53:23] Кушелев Александр Юрьевич: Понял
[18:53:48] Va12220(valqwa): "если она ставит по варанту 2 или 3, то не меять ничего" - например: "несколько примеров" в коде
[18:54:08] Va12220(valqwa): и т.д.
[20:01:06] Кушелев Александр Юрьевич: Вроде разобрался.
[20:01:09] Кушелев Александр Юрьевич:
1. Если встречается код 2 или 3, ничего не менять.
2. Если встречается код 1 или 4, запомнить их и поменять на 5.
3. Если второй раз подряд встречается код 1 или 4, замомнить и поменять на 5.
4. Если третий раз подряд встречается код 1 или 4, то в случае 1 запомнить и поменять на 5, а в случае 4 поменять два предыдущих кода на коды "4"
5. Если четвёртый раз подряд встречается код 1 или 4, то если последний код 1, три предыдущих поменять на коды "1". Если последний 4, то ничего не менять.
6. Если больше, чем 4 раза подряд встречается код 1 или 4 или их комбинация, то ничего не менять.
После первого прохода идёт второй:
7. Если встречается код Met, то если он 5, то не менять. Если он 1, то поменять на 6.

[20:21:04] Va12220(valqwa): противоречие 7 и 2
[20:21:21] Кушелев Александр Юрьевич: В чём?
[20:21:46] Va12220(valqwa): 1 который ты уже поменял в 2 на 5
поэтому в 7 не видишь 1
[20:22:07] Кушелев Александр Юрьевич: А в 4 они могут обратно поменяться
[20:22:31] Va12220(valqwa): 4 - особый исключительный случай
[20:22:37] Кушелев Александр Юрьевич: Нет
[20:22:56] Кушелев Александр Юрьевич: 4 случай - это начало альфа- или 310-спирали
[20:22:56] Va12220(valqwa): и что значит "запомнить и поменять"
[20:23:13] Кушелев Александр Юрьевич: Запомнить, чтобы можно было обратно поменять
[20:23:55] Кушелев Александр Юрьевич: А если там больше 3 раз подряд 1 или 4 (или смесь), то тут уже менять ничего не нужно. Это уже спираль продолжается
[20:30:58] Кушелев Александр Юрьевич: Не, это кривой алгоритм. Нужно по-другому.
[20:32:06] Кушелев Александр Юрьевич: 1. Если встретился код 2 или 3, ничего не менять.
2. Если встретился 4, то проверить, что впереди и сзади. Если символ N-1 и N-2 1 или 4, а N-3 2 или 3, то поменять символ N, N-1 и N-2 на 4. Если N-3 1 или 4, то ничего не менять. Если символ N+1 2 или 3, а N-1 или N-2 2 или 3, то символ N поменять на 5.
[20:53:38] Кушелев Александр Юрьевич: 3. Если встретился символ 1, то проверить, что спереди и сзади. Если спереди+сзади меньше 3 символов 1 или 4, символ N поменять на 5.
[20:54:42] Кушелев Александр Юрьевич: Опять как-то криво получается...
[20:56:05] Va12220(valqwa): угу. кривовато.
[20:56:45] Кушелев Александр Юрьевич: Надо включать счётчик символов типа 1 или 4. Если счётчик сбросился с номера 1 или 2 в 0, то поменять 1-2 символа 1 или 4 на 5
[20:56:45] Va12220(valqwa): давай возьмем какую нибудь "показательную" fast" последовательность и её будем разбирать
[20:56:58] Кушелев Александр Юрьевич: Не, лучше с логикой разобраться
[20:57:13] Кушелев Александр Юрьевич: Включаем счётчик на символе 1 или 4
[20:57:15] Va12220(valqwa): если с логикой - то это тебе делать сейчас надо
[20:57:22] Va12220(valqwa): тернируйся
[20:57:46] Кушелев Александр Юрьевич: Если счётчик дошёл до 3 и последний символ 4, то два предыдущих нужно поменять на 4.
[20:58:08] Кушелев Александр Юрьевич: Если счётчик дошёл до 4, то менять ничего не нужно.
[20:58:58] Кушелев Александр Юрьевич: Если счётчик дошёл до 3, и последний символ 1, после чего счётчик сбросился в 0, то все три символа нужно поменять на 5
[20:59:49] Va12220(valqwa): приведи наглядный пример
[21:00:08] Кушелев Александр Юрьевич: Один момент
[21:02:10] Кушелев Александр Юрьевич: 331334331133443314334133 -> 33533533553355335533
[21:02:39] Кушелев Александр Юрьевич: 31113 -> 35553
[21:02:57] Кушелев Александр Юрьевич: 31143 -> 34443
[21:03:21] Кушелев Александр Юрьевич: 34143 -> 34443
[21:03:38] Кушелев Александр Юрьевич: 31443 -> 34443
[21:04:16] Кушелев Александр Юрьевич: 34443 не менять
[21:04:23] Кушелев Александр Юрьевич: 311113 не менять
[21:04:43] Кушелев Александр Юрьевич: 341413 не менять
[21:05:01] Кушелев Александр Юрьевич: 344413 не менять
[21:06:33] Кушелев Александр Юрьевич: Короче, если счётчик единиц (четвёрок) дошёл до 4, то ничего не менять
[21:06:45] Кушелев Александр Юрьевич: Если дошёл до трёх и последняя была 4, то тоже ничего не менять
[21:06:46] Va12220(valqwa): это вот выглядит как-то "странно"
[21:02] Кушелев Александр Юрьевич:

31143 -> 34443
34143 -> 34443
31443 -> 34443 не получится ли, что последующие геометрические преобразования приведут к неверному виду? оч даже получится.

и я не вижу в втоем примере счетчик
[21:07:24] Кушелев Александр Юрьевич: Счётчик считает 1 и 4
[21:07:37] Va12220(valqwa): и ты брал в качестве рассматриваемых отрезков - отрезки по 5 цифр ПОСЛЕДОВАТЕЛЬНО
а если внутри таких отрезков есть правила что ты ранее говорил ?
[21:07:39] Кушелев Александр Юрьевич: Если досчитал до тёх и последний символ 4, то ничего не менять
[21:08:05] Кушелев Александр Юрьевич: Если достчитал до 4, то ничего не менять.
[21:08:30] Кушелев Александр Юрьевич: Если досчитал до трёх, последняя 1 и счётчик сбросился, то менять на 555
[21:09:02] Кушелев Александр Юрьевич: Если счётчик сбросился после двух, то менять на 55
[21:09:15] Кушелев Александр Юрьевич: Если счётчик сбросился после одного символа, то менять на 5
[21:09:30] Va12220(valqwa): экселем умеешь пльзоваться ?
[21:09:36] Кушелев Александр Юрьевич: Неа
[21:09:58] Кушелев Александр Юрьевич: Зато с логикой алгоритма практически прояснилось
[21:10:15] Кушелев Александр Юрьевич: Нужно завести счётчик символов 1(4)
[21:10:32] Кушелев Александр Юрьевич: И сбрасывать его символом 2(3)
[21:12:13] Va12220(valqwa): не понимаю я того что ты пишешь.
вот последовательность(верх) и счетчики снизу
1111141411411411344213
1234 - сейчас последняя 1 - что мне менять на 555 ?
[21:12:14] Кушелев Александр Юрьевич: Кстати, этот алгоритм можно и в скрипт Кушелева встроить.
[21:13:08] Кушелев Александр Юрьевич: Если счётчик не сбросился после третьей единицы, то уже ничего не менять.
[21:13:25] Va12220(valqwa): а почему он не сбросился после 3й единицы ?
[21:13:40] Кушелев Александр Юрьевич: А потому что у тебя 4-ый символ не 2 и не 3
[21:16:16] Кушелев Александр Юрьевич: А если он сбросился после третьего символа, и он оказался "1", то все три нужно менять на 555, а если третий был 4, но все менять на 444
[21:16:19] Va12220(valqwa): хорошо
дальше
1111141411411411344213
1234123
1234_сбрасывание счетчика в 1(см выше)
[21:16:29] Va12220(valqwa): дальше как быть?
[21:17:24] Va12220(valqwa): по-твоему я сбрасываю счеткик после 4ки или после встреченного кода 2 или 3
[21:17:26] Кушелев Александр Юрьевич: Дальше начинаем считать с ближайшей 1 или 4
[21:17:54] Кушелев Александр Юрьевич: Сбрасывать надо на 2 или 3
[21:17:56] Va12220(valqwa): 1111141411411411344213
1234
распиши дальше ступеньчато
[21:18:56] Кушелев Александр Юрьевич: 1111141411411411344213
123456789... на тройке будет 0
[21:19:17] Кушелев Александр Юрьевич: После тройки начинаем сначала:
[21:19:45] Кушелев Александр Юрьевич: 344213
012010
[21:20:32] Кушелев Александр Юрьевич: 344213 -> 355253
[21:21:30] Va12220(valqwa): а теперь посмотри на свою картинку

Изображение

последовательность из неё взята
[21:22:01] Кушелев Александр Юрьевич: На втором проходе Met нужно будет с 1 на 6 поменять
[21:22:32] Va12220(valqwa): там 2 мета ! а менять надо в 1м случае ?
[21:22:54] Кушелев Александр Юрьевич: Не понял. Что за 2 мета?
[21:23:13] Va12220(valqwa): там второй и 4й единичке соответствует МЕТ
[21:23:20] Кушелев Александр Юрьевич: Оба
[21:23:22] Va12220(valqwa): а ты меняешь на 6 только вторую на картинке
[21:23:31] Кушелев Александр Юрьевич: Я первый не заметил
[21:23:37] Кушелев Александр Юрьевич: Он и не имеет значения
[21:23:46] Кушелев Александр Юрьевич: Но по алгоритму надо менять оба
[21:23:51] Va12220(valqwa): все имеет значение.
[21:24:23] Кушелев Александр Юрьевич: Менять, менять...
[21:24:53] Кушелев Александр Юрьевич: На самом деле первый символ не имеет смысла
[21:26:05] Va12220(valqwa): второй на твоей картинке
[21:26:11] Va12220(valqwa): второй МЕТ там
[21:26:15] Кушелев Александр Юрьевич: А хотя ... тут не всё так просто...
[21:26:40] Кушелев Александр Юрьевич: Второй точно надо менять
[21:27:16] Кушелев Александр Юрьевич: Начало белка погоды не делает. Поэтому лучше пусть по общему алгоритму будет

[21:46:37] Va12220(valqwa): ну давай попробуем.
фаст последовательность какую взять ?
[21:46:57] Кушелев Александр Юрьевич: момент
[21:47:12] Кушелев Александр Юрьевич: FT CDS 1..492
ATGGAAGCTA GGAGCCGGGC TCCCAGAAGA CAGCTGTGCC CGCCTGGGAT CACTTGGCTG
GCCCTGGCCT ATCTGCTCAG CTGCCTGCTT GCCTCCAGCA AGGCCAAGGT CTTCAGTCGC
TGTGAGCTGG CCAAAGAGAT GCATGACTTC GGTCTGGATG GCTACCGGGG TTATAACCTG
GCTGACTGGG TCTGCCTTGC TTACTACACA AGTGGCTTCA ACACAAATGC TGTGGATCAT
GAAGCTGATG GAAGCACCAA CAATGGCATC TTCCAGATCA GCAGCCGGAG GTGGTGCAGA
ACCCTCGCCT CGAATGGCCC CAATCTTTGC AGGATATACT GCACTGATTT GTTGAACAAT
GATCTCAAAG ATTCTATCGT CTGTGCCATG AAGATAGTTC AAGAACCCCT GGGTCTGGGC
TATTGGGAAG CCTGGAGGCA CCACTGCCAG GGCAGGGACC CCAGTGACTG GGTGGATGGC
TGTGACTTCT AG
//
[21:47:26] Кушелев Александр Юрьевич: Это dne
[21:48:20] Кушелев Александр Юрьевич: А это fasta:
[21:48:21] Кушелев Александр Юрьевич: >ENA|AAS77887|AAS77887.1 Mus musculus (house mouse) lysozyme-like protein 3
ATGGAAGCTAGGAGCCGGGCTCCCAGAAGACAGCTGTGCCCGCCTGGGATCACTTGGCTG
GCCCTGGCCTATCTGCTCAGCTGCCTGCTTGCCTCCAGCAAGGCCAAGGTCTTCAGTCGC
TGTGAGCTGGCCAAAGAGATGCATGACTTCGGTCTGGATGGCTACCGGGGTTATAACCTG
GCTGACTGGGTCTGCCTTGCTTACTACACAAGTGGCTTCAACACAAATGCTGTGGATCAT
GAAGCTGATGGAAGCACCAACAATGGCATCTTCCAGATCAGCAGCCGGAGGTGGTGCAGA
ACCCTCGCCTCGAATGGCCCCAATCTTTGCAGGATATACTGCACTGATTTGTTGAACAAT
GATCTCAAAGATTCTATCGTCTGTGCCATGAAGATAGTTCAAGAACCCCTGGGTCTGGGC
TATTGGGAAGCCTGGAGGCACCACTGCCAGGGCAGGGACCCCAGTGACTGGGTGGATGGC
TGTGACTTCTAG
[21:49:04] Va12220(valqwa): оки. хорошо. сейчас минут 10-20 повожусь. настрою
[21:49:27] Кушелев Александр Юрьевич: Эти шутники всё время стандарты расширяют. Появились новые "фасты", которые программа от Prosolver не понимает
[21:52:51] Va12220(valqwa): мне все равно
[21:54:58] Кушелев Александр Юрьевич: Вот такую фасту программа Prosolver не берёт:
[21:54:59] Кушелев Александр Юрьевич: >NM_014656.2 Homo sapiens KIAA0040 (KIAA0040), transcript variant 2, mRNA
TCCCACGACCTTGGCCGGCGCCGGGGCCCTACACGCCAGACCTGGCTCGGGGTGGGAGTGCAGAGGCAAC
CAAAAAGGAACCCACACCTCCCTCCAGGGCCCGGGGCGCTGTCAGACGGGGCAGCAACCAGGAGATTCCC
[21:55:21] Кушелев Александр Юрьевич: Говорит, что ей не хватает ENA<
[21:56:05] Кушелев Александр Юрьевич: Ты можешь подправить программу, чтобы она первую строчку игнорировала, но брала оттуда название файла
[21:56:11] Кушелев Александр Юрьевич: Точнее название белка
[21:56:18] Кушелев Александр Юрьевич: Идентификатор
[21:56:38] Кушелев Александр Юрьевич: Или первые символов 30. Там он точно будет
[21:57:33] Кушелев Александр Юрьевич: Можно даже всю первую строчку загнать в графический файл, но только разбить на короткие строчки, чтобы графический файл шире не стал.
[21:59:13] Va12220(valqwa): сейчас не могу. у меня нет сейчас оболочки паскаля что бы разбираться с паскалем (старым очень к тому же )
[22:01:10] Va12220(valqwa): это нужно же заново потом перекомпилировать и создать исполняемый файл. гемороя хватит не на один час и не на два )
[22:02:06] Va12220(valqwa): если тебе так важно, то мне проще сделать тоже самое
https://img-fotki.yandex.ru/get/198998/158289418.3c1/0_17066a_325fac7_orig.png
на своем инструменте
[22:03:59] Кушелев Александр Юрьевич: Мне без разницы, на каком. Важно исходный алгоритм зафиксировать, чтобы можно было в скрипт Кушелева встроить. Тогда я смогу на Маше продублировать всё.
[22:04:45] Va12220(valqwa): не понял. что в маше продублировать ?
[22:04:58] Кушелев Александр Юрьевич: Алгоритм превращения 1234 в 123456
[22:05:26] Кушелев Александр Юрьевич: У меня сейчас скрипт строит 3D модель без радикалов по композиционному коду
[22:05:40] Кушелев Александр Юрьевич: Я на нём могу углы настраивать для вариантов 123456
[22:06:03] Кушелев Александр Юрьевич: Но в моём скрипте нет алгоритма перекодировки 1234 в 123456
[22:06:11] Va12220(valqwa): а какой "исходный" ?
[22:06:25] Кушелев Александр Юрьевич: Ты же в своей программе его делаешь?
[22:06:41] Va12220(valqwa): твой алгоритм берет композиционный код ?
[22:06:41] Кушелев Александр Юрьевич: Вот и в скрипт его хорошо бы тоже вставить
[22:06:46] Кушелев Александр Юрьевич: Да
[22:06:56] Кушелев Александр Юрьевич: И строит кольцегранную модель без радикалов
[22:07:09] Va12220(valqwa): и он сейчас берет 1234
а ты хочешь получить комп код 123456
и уже с ним работать ?
[22:07:34] Кушелев Александр Юрьевич: Да, но я хочу и алгоритм в скрипт вставить, чтобы он сам из 1234 делал 123456
[22:07:54] Va12220(valqwa): ну вставь - ты же мне его рассказал только что
[22:08:10] Кушелев Александр Юрьевич: Я его не могу в виде скрипта написать
[22:08:25] Va12220(valqwa): а как собрался тогда вставлять ?
[22:08:49] Кушелев Александр Юрьевич: Глядя на твой исходник может получится его в виде скрипта написать
[22:10:01] Va12220(valqwa): ну ну
[22:10:03] Кушелев Александр Юрьевич: Скрипт хорош тем, что я его могу модифицировать сам
[22:10:38] Кушелев Александр Юрьевич: Не нужно будет ждать твоего очередного возвращения, чтобы исправить 20 градусов на 22 градуса или наоборот
[22:11:35] Кушелев Александр Юрьевич: А после того, как наберётся критическое количество доработок, ты уже новую версию напишешь
[22:12:22] Va12220(valqwa): давай попробуем
[22:12:31] Кушелев Александр Юрьевич: Давай
[22:13:54] Кушелев Александр Юрьевич: Кстати, мне от программы Prosolver нужно в первую очередь код 123456, а не графика
[22:14:02] Кушелев Александр Юрьевич: Графика она такой же останется
[22:14:11] Кушелев Александр Юрьевич: Тольцо цифры в столбцах поменяются
[22:14:27] Кушелев Александр Юрьевич: Для скрипта мне только цифры и нужны
[22:14:47] Кушелев Александр Юрьевич: В виде текстового файла
[22:15:34] Кушелев Александр Юрьевич: Но чтобы две программы не запускать, хотелось бы и цветные столбцы видеть сразу

[22:19:07] Va12220(valqwa): так как на картинке ?
[22:20:51] Кушелев Александр Юрьевич: Да, но два столбца там не нужно. Только новый с новыми цифрами. Хотя для проверки может и старый пригодиться...
[22:21:09] Кушелев Александр Юрьевич: После отладки старый будет не нужен
[22:22:25] Va12220(valqwa): но для 5 и 6 видимо должны быть иные обозначения в цветных столбцаХ?
[22:23:08] Кушелев Александр Юрьевич: Да. Они и были раньше. 5 был розовым, а 6 нужно сделать сиреневым
[22:23:38] Va12220(valqwa): а размер - полный прямоугольник ?
[22:23:53] Кушелев Александр Юрьевич: А размер оставить, как был
[22:24:00] Va12220(valqwa): а я не знаю какой он был
[22:24:11] Кушелев Александр Юрьевич: Так у тебя же картинка есть
[22:24:35] Va12220(valqwa): на картнке 6 - полный а 5 - половинный ТАК ?
[22:25:25] Кушелев Александр Юрьевич: Розовый пусть будет другой формы вообще. Сейчас нарисую
[22:29:38] Кушелев Александр Юрьевич: Розовый нужно сделать из зелёного. Т.е. такой же формы, как зелёный, только розовый
[22:29:51] Кушелев Александр Юрьевич: Сможешь?
[22:31:11] Кушелев Александр Юрьевич: Розовый на самом деле должен быть красно-розовым
[22:31:25] Кушелев Александр Юрьевич: Яркая часть средняя красная, а окантовочка розовая.
[22:32:04] Кушелев Александр Юрьевич: Из зелёного в Фотошопе перекрасить изменением оттенка
[22:32:25] Кушелев Александр Юрьевич: У меня просто фотошопа нет
[22:32:34] Кушелев Александр Юрьевич: Не тянет этот комп...
[22:34:07] Va12220(valqwa): )) в маше нарисуй ;)
[22:35:14] Кушелев Александр Юрьевич: Ддразниться? Замени цифры в Color cо второй позиции(зеленый) на первую (красный), и всех делов
[22:38:08] Va12220(valqwa): ладно. нарисую конечно.
отдыхай пока что ) можно сказать день не зря прожит.
[22:38:31] Кушелев Александр Юрьевич: Да. Алгоритм нарисовался, однако...

[22:41:02] Va12220(valqwa): я сейчас беру
>ENA|AAS77887|AAS77887.1 Mus musculus (house mouse) lysozyme-like protein 3
ATGGAAGCTAGGAGCCGGGCTCCCAGAAGACAGCTGTGCCCGCCTGGGATCACTTGGCTG
GCCCTGGCCTATCTGCTCAGCTGCCTGCTTGCCTCCAGCAAGGCCAAGGTCTTCAGTCGC
TGTGAGCTGGCCAAAGAGATGCATGACTTCGGTCTGGATGGCTACCGGGGTTATAACCTG
GCTGACTGGGTCTGCCTTGCTTACTACACAAGTGGCTTCAACACAAATGCTGTGGATCAT
GAAGCTGATGGAAGCACCAACAATGGCATCTTCCAGATCAGCAGCCGGAGGTGGTGCAGA
ACCCTCGCCTCGAATGGCCCCAATCTTTGCAGGATATACTGCACTGATTTGTTGAACAAT
GATCTCAAAGATTCTATCGTCTGTGCCATGAAGATAGTTCAAGAACCCCTGGGTCTGGGC
TATTGGGAAGCCTGGAGGCACCACTGCCAGGGCAGGGACCCCAGTGACTGGGTGGATGGC
TGTGACTTCTAG
и начинаю с ним работать,
сначала получаю 4х кодовый вариант
и затем его перевожу в 6ти кодовый

и тебе пересылаю 2 текстовых файла последовательностей.
[22:42:18] Кушелев Александр Юрьевич: ОК
[22:43:12] Кушелев Александр Юрьевич: Может лучше сразу с графическим файлом сделать. Тогда легче будет проверять
[22:43:29] Кушелев Александр Юрьевич: Ну и полосочки цветные настроение поднимают...
[22:44:24] Va12220(valqwa): извини. все по очереди.
4->6 мне надо сейчас запрограммировать.
а потом "навесить" картинку будет легче
[22:44:36] Кушелев Александр Юрьевич: Давай так
[22:52:03] Va12220(valqwa): цифры должны идти без пробелов ?
[22:52:56] Кушелев Александр Юрьевич: вместо пробелов нужны запятые
[22:53:17] Va12220(valqwa): момент
[22:53:27] Кушелев Александр Юрьевич: И в строке 30 цифр и 30 запятых
[22:54:35] Va12220(valqwa): тогда пару моментов )
[22:56:42] Кушелев Александр Юрьевич: 1,1,1,1,1,1,1,1,1,1,4,1,1,1,1,1,3,1,1,3,2,4,1,1,1,1,1,3,1,1,4,4,3,1,1,1,1,1,4,3,3,1,4,4,4,2,3,1,3,1,
1,1,3,3,3,3,4,1,3,1,3,1,3,1,3,3,1,1,1,1,4,1,4,2,1,3,1,1,1,1,3,3,1,3,2,4,3,4,1,3,1,1,1,4,3,1,1,1,4,3,
3,1,1,1,3,1,2,2,1,1,1,1,4,1,1,1,1,1,2,2,1,1,3,1,3,1,1,3,1,3,3,1,2,1,3,1,3,1,3,3,1,3,3,1,1,1,3,4,3,1,
1,1,1,3,3,3,3,1,1,1,1,3,3,1,4,1,1,1,4,1,1,3,1,1,1,4,1,3,2,1,1,4,1,1,1,2,3,1,3,3,1,1,3,3,3,3,1,3,3,4,
4,1,1,1,1,2,4,1,3,1,3,1,1,1,2,1,1,3,1,1,3,3,3,1,1,1,4,3,3,1,1,4,1,1,3,1,3,4,3,1,3,2,1,1,4,2,3,1,1,1,
1,1,3,3,1,3,3,1,1,4,1,3,1,3,4,1,1,3,1,1,1,1,1,4,1,1,3,1,1,3,1,3,1,2
[22:56:51] Кушелев Александр Юрьевич: Такой примерно вид
[22:56:57] Va12220(valqwa): я понял
[22:57:16] Кушелев Александр Юрьевич: Я этот код прямо в скрипт вставляю

Пикотехнология белков, ДНК, РНК - 2

Изображение

Кушелев: Любопытный фрагмент лизоцима (альтернативный человеческий). Met 30 - Cys 31. Интересно, могут ли соединиться дисульфидным мостиком радикалы этих соседних аминокислотных остатков? :)

Пикотехнология белков, ДНК, РНК - 2

Skype, 2017-01-16:

[15.01.2017 23:33:28] Va12220(valqwa): а так прочтешь ?

1,3,3,1,1,4,3,1,3,3,1,4,1,4,3,4,1,3,1,4,1,4,1,3,4,1,1,1,4,3,1,1,1,1,1,1,1,1,3,1,3,1,4,1,3,1,1,3,1,1,
3,4,3,1,1,4,3,3,1,4,3,1,1,1,1,3,3,1,1,2,3,1,1,1,2,3,3,4,3,3,3,3,3,2,1,1,1,3,1,1,1,1,1,1,1,4,1,1,1,3,
1,1,1,4,3,1,1,3,3,1,1,2,1,1,3,3,1,1,1,3,3,1,3,3,3,1,1,3,1,1,1,2,3,3,3,1,4,3,4,1,3,1,3,1,1,1,1,1,1,1,
1,1,1,1,3,1,1,4,3,1,3,1,1,

[15.01.2017 23:35:19] Va12220(valqwa): ктсати в твоем "примере" в строке не 30 цифр а 50!
[15.01.2017 23:37:19] Кушелев Александр Юрьевич: Годится!
[15.01.2017 23:37:33] Кушелев Александр Юрьевич: Можно и 50 сделать
[15.01.2017 23:37:37] Va12220(valqwa): там в конце запятая - она не мешает ?
[15.01.2017 23:37:40] Кушелев Александр Юрьевич: 50 даже удобнее будет
[15.01.2017 23:37:47] Кушелев Александр Юрьевич: Не, не мешает
[15.01.2017 23:38:12] Va12220(valqwa): хорошо. исправлю на 50 символов в строке
[15.01.2017 23:38:17] Кушелев Александр Юрьевич: ОК

1,3,3,1,1,4,3,1,3,3,1,4,1,4,3,4,1,3,1,4,1,4,1,3,4,1,1,1,4,3,1,1,1,1,1,1,1,1,3,1,3,1,4,1,3,1,1,3,1,1,
3,4,3,1,1,4,3,3,1,4,3,1,1,1,1,3,3,1,1,2,3,1,1,1,2,3,3,4,3,3,3,3,3,2,1,1,1,3,1,1,1,1,1,1,1,4,1,1,1,3,
1,1,1,4,3,1,1,3,3,1,1,2,1,1,3,3,1,1,1,3,3,1,3,3,3,1,1,3,1,1,1,2,3,3,3,1,4,3,4,1,3,1,3,1,1,1,1,1,1,1,
1,1,1,1,3,1,1,4,3,1,3,1,1,

[15.01.2017 23:42:58] Va12220(valqwa): 4х кодовый файл будет таким
[15.01.2017 23:43:10] Va12220(valqwa): сейчас займусь перекодировкой в 6ти кодовый вариант
[0:13:36] Va12220(valqwa): 344213
012010
344213 -> 355253
тут вторая пятерка не описана у тебя никакой логикой ранее
получается что после 0 (на двойке) идет 1 - ей счетчик 1
затем идет тройка - обнуление счетчика
НО! счетчик не 2 и не 3 - т.е. нету комбинации что ты ранее описал
а ты ранее описывал что меняются на 5ки только если счетчик 2 или 3

и это касается как 1 так и 4к
[0:19:19] Кушелев Александр Юрьевич: Не
[0:20:26] Кушелев Александр Юрьевич: Если счётчик обнуляется на следующем символе (N+1), то 1 и 4 превращаются в пятёрки. Если на N+2 тоже
[0:21:37] Кушелев Александр Юрьевич: Если N+3, то N, N+1 и N+2 становятся четверками, если N+2 четверка и пятерками, если 1
[0:22:30] Va12220(valqwa): т.е. важно срабатывание обнуления после 1го, 2х, или 3х кодовых цифр
а после 4х и далее уже не важно и замен не делается.
[0:22:43] Кушелев Александр Юрьевич: Да
[0:22:50] Va12220(valqwa): момент - исправлю чуток
[0:40:55] Va12220(valqwa): а теперь посмотри

>ENA|AAS77887|AAS77887.1 Mus musculus (house mouse) lysozyme-like protein 3
ATGGAAGCTAGGAGCCGGGCTCCCAGAAGACAGCTGTGCCCGCCTGGGATCACTTGGCTG
GCCCTGGCCTATCTGCTCAGCTGCCTGCTTGCCTCCAGCAAGGCCAAGGTCTTCAGTCGC
TGTGAGCTGGCCAAAGAGATGCATGACTTCGGTCTGGATGGCTACCGGGGTTATAACCTG
GCTGACTGGGTCTGCCTTGCTTACTACACAAGTGGCTTCAACACAAATGCTGTGGATCAT
GAAGCTGATGGAAGCACCAACAATGGCATCTTCCAGATCAGCAGCCGGAGGTGGTGCAGA
ACCCTCGCCTCGAATGGCCCCAATCTTTGCAGGATATACTGCACTGATTTGTTGAACAAT
GATCTCAAAGATTCTATCGTCTGTGCCATGAAGATAGTTCAAGAACCCCTGGGTCTGGGC
TATTGGGAAGCCTGGAGGCACCACTGCCAGGGCAGGGACCCCAGTGACTGGGTGGATGGC
TGTGACTTCTAG

Код 4:
1,3,3,1,1,4,3,1,3,3,1,4,1,4,3,4,1,3,1,4,1,4,1,3,4,1,1,1,4,3,1,1,1,1,1,1,1,1,3,1,3,1,4,1,3,1,1,3,1,1,
3,4,3,1,1,4,3,3,1,4,3,1,1,1,1,3,3,1,1,2,3,1,1,1,2,3,3,4,3,3,3,3,3,2,1,1,1,3,1,1,1,1,1,1,1,4,1,1,1,3,
1,1,1,4,3,1,1,3,3,1,1,2,1,1,3,3,1,1,1,3,3,1,3,3,3,1,1,3,1,1,1,2,3,3,3,1,4,3,4,1,3,1,3,1,1,1,1,1,1,1,
1,1,1,1,3,1,1,4,3,1,3,1,1,

Код 6:
1,3,3,5,5,5,3,1,3,3,1,4,1,4,3,5,5,3,1,4,1,4,1,3,4,1,1,1,4,3,1,1,1,1,1,1,1,1,3,1,3,5,5,5,3,5,5,3,5,5,
3,4,3,5,5,5,3,3,5,5,3,1,1,1,1,3,3,5,5,2,3,5,5,5,2,3,3,4,3,3,3,3,3,2,5,5,5,3,1,1,1,1,1,1,1,4,1,1,1,3,
1,1,1,4,3,5,5,3,3,5,5,2,5,5,3,3,5,5,5,3,3,1,3,3,3,5,5,3,5,5,5,2,3,3,3,5,5,3,5,5,3,1,3,1,1,1,1,1,1,1,
1,1,1,1,3,5,5,5,3,1,3,1,1,

[0:43:59] Кушелев Александр Юрьевич: Вроде нормально
[0:44:00] Va12220(valqwa): осталось "приклеить" проверку на МЕТ
[0:44:53] Кушелев Александр Юрьевич: Да. Если он после первого преобразования стал 5, то пусть и остаётся 5. Если остался 1, то должен стать 6
[0:49:40] Va12220(valqwa): Met это группа atg
встречается во всем перечне только один раз
[0:52:27] Кушелев Александр Юрьевич: Да
[0:53:43] Кушелев Александр Юрьевич: Для теста можно модифицировать входной файл, чтобы там было несколько Met

[1:10:40] Va12220(valqwa):
6,3,3,5,5,5,3,1,3,3,1,4,1,4,3,5,5,3,1,4,1,4,1,3,4,1,1,1,4,3,1,1,1,1,1,1,1,1,3,1,3,5,5,5,3,5,5,3,5,5,
3,4,3,5,5,5,3,3,5,5,3,1,1,1,1,3,3,5,5,2,3,5,5,5,2,3,3,4,3,3,3,3,3,2,5,5,5,3,1,1,1,1,1,1,1,4,1,1,1,3,
1,1,1,4,3,5,5,3,3,5,5,2,5,5,3,3,5,5,5,3,3,1,3,3,3,5,5,3,5,5,5,2,3,3,3,5,5,3,5,5,3,1,3,1,1,1,1,1,1,1,
1,1,1,1,3,5,5,5,3,1,3,1,1,

[1:12:54] Кушелев Александр Юрьевич: Отлично! Пора делать цветные полоски :)
[1:13:03] Va12220(valqwa): "приклеил" 6-ку.

в данном тестовом файле она на 1м месте
хотя вообще то Мет встречается в файле 3 раза
1 45 и 130е
[1:13:50] Кушелев Александр Юрьевич: И там он под номером 5 ?
[1:16:49] Va12220(valqwa): 1 - 6-ка
остальные не смотрел. видимо 5 - у меня проверка на 1ку поставлена.
сейчас проверю
1-47-130
[1:16:58] Va12220(valqwa): да. там 5ки (47е и 130е место
[1:17:35] Кушелев Александр Юрьевич: Отлично
[1:17:48] Кушелев Александр Юрьевич: Когда сможешь с цветными полосками сделать?
[1:18:15] Va12220(valqwa): сейчас и вожусь
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Сообщение #28 Kushelev » 17.01.2017, 04:11

Изображение
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев


Вернуться в Уголок Кушелева

Кто сейчас на форуме (по активности за 5 минут)

Сейчас этот раздел просматривают: 1 гость

cron