Создание средства для продления жизни

Board index Альтернативная Физика Уголок Кушелева

Moderator: Kushelev

Post #1by Kushelev » 03.02.2017, 18:23

Создание средства для продления жизни

odincevatel wrote:механизм старения млекопитающих, включая человека, обусловлен маленьким цитокином размером 10 килодальтон, который был нами назван как фактор старения. Указанный фактор появляется в конце первой трети средней продолжительности жизни организма и вызывает пролиферацию клеток соединительной ткани, глии мозга, что приводит к гибели нейронов, к старению и гибели мозга, к старению и гибели организма.

http://www.uniprot.org/uniprot/P10145

http://www.ebi.ac.uk/ena/data/view/AAA35611

>ENA|AAA35611|AAA35611.1 Homo sapiens (human) hypothetical protein
ATGACTTCCAAGCTGGCCGTGGCTCTCTTGGCAGCCTTCCTGATTTCTGCAGCTCTGTGT
GAAGGTGCAGTTTTGCCAAGGAGTGCTAAAGAACTTAGATGTCAGTGCATAAAGACATAC
TCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACAC
TGCGCCAACACAGAAATTATTGTAAAGCTTTCTGATGGAAGAGAGCTCTGTCTGGACCCC
AAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAATTCATAA

Композиционный код-4:

1,3,1,1,4,1,4,3,1,1,2,1,1,4,3,3,2,3,4,3,3,3,2,3,1,2,1,3,3,3,3,3,3,3,1,1,2,1,2,1,1,3,3,1,1,1,3,3,1,3,
3,4,3,4,3,1,3,2,2,1,1,1,1,2,3,3,3,2,1,3,3,3,2,3,1,1,3,4,1,1,1,3,1,1,4,1,1,3,4,1,1,3,1,1,1,3,1,3,2,0,

Композиционный код-6:

5,3,1,1,4,1,4,3,5,5,2,4,4,4,3,3,2,3,5,3,3,3,2,3,5,2,5,3,3,3,3,3,3,3,5,5,2,5,2,5,5,3,3,5,5,5,3,3,5,3,
3,5,3,5,3,5,3,2,2,1,1,1,1,2,3,3,3,2,5,3,3,3,2,3,5,5,3,4,1,1,1,3,1,1,4,1,1,3,5,5,5,3,5,5,5,3,5,3,2,0,

Image

odincevatel wrote:мне 88-й год, всё в порядке, вся жизнь впереди. Утром на стакан воды комнатной температуры вы делаете 10-12 прысков и через полчаса выпиваете эту воду, и вы идёте выполнять, перевыполнять, кувыркаться, любить, наслаждаться жизнью, ну, и строгать - всё как полагается. Всё! Учитывая мой возраст, автор сказал: "Виктор Абрамович, хватит изображать из себя молодого человека, прыскайте 20 раз". Я прыскаю 20 раз.

Кушелев: ЗдОрово! Но это не радикальное решение. Это в лучшем случае - отсрочка на несколько десятков лет, а в худшем - иллюзия.

Я же предлагаю отключить механизм старения и вернуть молодость. Но для этого нужно идентифицировать сигнал отключения механизма старения.

Виктория Соколик опубликовала предложение лаборатории, которая может нам помочь, если найдутся инвесторы: http://nanoworld.org.ru/topic/3/page/43/

Цитата: Для экспериментального анализа микроРНК экзосом:
Top-quality miRNA studies from pure exosomes
Diagenode
New seamless exosome isolation solution for miRNA studies
Diagenode guarantees the purest isolation of exosomes from biofluids and liquid biopsies for:
High-quality CATS RNA-seq library preparation
High yields of miRNAs from our new superior exosome isolation workflow
Learn more about superior exosome isolation and miRNA-seq
Kushelev M
Topic author
Avatar
Location: г.Дмитров
Reputation: -204
Posts: 3307
Topics: 233
With us: 3 yaers 10 months

Post #2by Kushelev » 24.02.2017, 12:42

http://nanoworld.org.ru/post/84235/#p84235

vitanar wrote:Зачем открывать что-то, если всё уже сделано до нас. Вон в Гималаях одно небольшое племя питается практически только абрикосами - свежими, сухими, компотами и абрикосовыми косточками. И живут до 160 лет, а заодно раком совсем не болеют. Так может стоит перенаправить усилия на изучение этого феномена. Лучше синица в руке, чем журавль в небе.

Кушелев: Даже если это было бы правдой, т.е. что люди действительно могут дожить до 160, то и в этом случае я бы сказал, что лучше 100 лет полноценной жизни в репродуктивном возрасте, чем 200 лет старческих мук.

Но в реальности больше 120 лет люди не живут. На земле есть несколько человек в возрасте от 120 до 129 лет, но они не в счёт.

А сказки про 160 лет имеют ту же ценность, что и щелочные свойства лимонной кислоты :)

Added after 2 hours 22 minutes:
vitanar wrote:Человек стал что попало есть и пить, с кем попало спать, где попало жить. В результате сократил продолжительность своей жизни от бесконечности до 70 лет.

Кушелев: Вы почти угадали. Только запрограммированная продолжительность жизни не уменьшалась, а увеличивалась в процессе эволюции.

Амёба, например, от старости не умирает, но среднее время жизни в естественных условиях около 40 минут. Едят-С...

У мышей, например, запрограммированная смерть наступает где-то через 2 года (самые короткоживущие виды). Коэффициент по сравнению с человеком около 50.
У кошек коээфициент по сравнению с человеком уже около 7. и т.д.

Added after 2 hours 46 minutes:
Создание средства для продления жизни

vitanar wrote:что, сами животные об этом говорят?

Продолжительность жизни слабо зависит от рациона питания, если он не сильно вредит здоровью.

Если Вы хотите разобраться, как определяется средняя продолжительность жизни биологического вида, изучите матчасть. Зачем гадать-то, когда это опубликовано?

Image
Подробнее: http://nanoworld88.narod.ru/data/212.htm
Kushelev M
Topic author
Avatar
Location: г.Дмитров
Reputation: -204
Posts: 3307
Topics: 233
With us: 3 yaers 10 months

Post #3by Kushelev » 24.02.2017, 20:37

Создание средства для продления жизни

vitanar wrote:многие доживают до 150-160 лет.

Да ладно... Пишите сразу 1500-1600. Чего уж мелочиться? ;)

Кстати, 100 и 200 лет - разница не принципиальная, а эликсир, возвращающий молодость, возвращает её навсегда. Вам хочется 100 лет быть дряхлым стариком или неограниченное время 30-летним, полным жизни человеком?
Kushelev M
Topic author
Avatar
Location: г.Дмитров
Reputation: -204
Posts: 3307
Topics: 233
With us: 3 yaers 10 months


Return to Уголок Кушелева

Who is online (over the past 5 minutes)

Users browsing this forum: 1 guest

cron