Пикотехнология-2017 создана!

Список разделов Альтернативная Физика Уголок Кушелева

Модератор: Kushelev

Сообщение #1 Kushelev » 20.01.2017, 17:05

Формы, механизмы, энергия наномира. Сообщение 84 653

Пикотехнология белков, ДНК, РНК - 2

Skype:

[19.01.2017 17:03:19] Кушелев Александр Юрьевич: В таблице 3 разных TKD (терминирующих кодона).
[19.01.2017 17:03:26] Кушелев Александр Юрьевич: Картинка правильная
[19.01.2017 17:03:34] Va12220(valqwa): вот и пиши разъясняй
[19.01.2017 17:03:42] Va12220(valqwa): я домой
[19.01.2017 17:04:26] Кушелев Александр Юрьевич: Картинка правильная для var 4
[19.01.2017 17:04:44] Кушелев Александр Юрьевич: Она же должна повториться и в столбце var 6
[19.01.2017 17:05:10] Кушелев Александр Юрьевич: TKD не нужно ни на что менять.
[19.01.2017 17:05:41] Кушелев Александр Юрьевич: А композиционный код у TKD лучше сделать не "1", а "0"
[19.01.2017 17:05:54] Кушелев Александр Юрьевич: И никогда не менять
[19.01.2017 17:06:36] Кушелев Александр Юрьевич: В таблице композиционного кода придётся исправить коды для TKD
[19.01.2017 17:06:45] Кушелев Александр Юрьевич: На "0"
[19.01.2017 18:07:47] Кушелев Александр Юрьевич: И всё же непонятно, почему твоя программа выводит картинку через полчаса, а программа от Prosolver через 1 секунду? В чём секрет?
[19.01.2017 18:09:16] Кушелев Александр Юрьевич: Быстродействие отличается в несколько тысяч раз!
[19.01.2017 18:27:59] Va12220(valqwa): потому что в среде выполняется программа
http://rsload.net/news/25611-uchenye-sdelali-iz-nokia-lumia-1020-mikroskop-dlya-analiza-dnk.html
[19.01.2017 18:47:00] Va12220(valqwa): но как тогда анализировать комп код. если появится ещё и 0 - счетчик что будет делать?
[19.01.2017 19:17:29] Кушелев Александр Юрьевич: Сбрасываться
[19.01.2017 19:17:55] Кушелев Александр Юрьевич: На терминирующем коде белок заканчивается. После него начинается новый белок
[19.01.2017 19:18:20] Кушелев Александр Юрьевич: Может быть тормозит сильно из-за динамического перераспределения памяти?
[19.01.2017 19:18:24] Va12220(valqwa): т.е. счетчик надо обнулять?
[19.01.2017 19:18:27] Кушелев Александр Юрьевич: Задать массивы сразу по максимуму
[19.01.2017 19:18:30] Кушелев Александр Юрьевич: Да
[19.01.2017 19:19:17] Кушелев Александр Юрьевич: Полчаса ждать это некуда не годится.
[19.01.2017 19:19:46] Кушелев Александр Юрьевич: Попробуй задать массивы статически
[19.01.2017 19:22:44] Кушелев Александр Юрьевич: А твоя программа dne ещё не понимает?
[19.01.2017 19:24:00] Va12220(valqwa): это легко сделать. сначала поправлю это

на любом из 3х терм коде сбрасывать счетчик и начинать новый белок
[19.01.2017 19:27:42] Кушелев Александр Юрьевич: Да
[19.01.2017 19:33:48] Va12220(valqwa): хорошо. отдыхай. )
[1:35:55] Кушелев Александр Юрьевич: Привет!
[1:36:14] Кушелев Александр Юрьевич: Что-то с этим файлом fasta твоя программа работать отказывается:
[1:36:15] Кушелев Александр Юрьевич: >ENA|LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
AAGGCCAACAAGGCCGCCCGCACCCGTGATGTTTTCAACGACAAAGTTGATACCCATCTGCGTAGAAA
GTGCGCTGGTGACGTAACGCACTGCGATGTCTGAGGCGCTGCCGGCCTGCAAGGGGAGCCCCACGGTCAC
CGGATTGCCGAAGCTGTGTTTTTGAGCCATTGATAAACTGGGCCAAAAGGCGACGCCACAGGCTGCTGCG
CCTGCTTTGAGAAAGGTTCTTTTAATCATTAAGTCTCTCGCTGCCCACATTAGGGTCAAAATGTTTAACC
TTAGTATTTGAAATTTACTCTGTTTTTGAGATGATGTCACATGTCAAAATAAGGCTGACTAAATGGTCAA
ATGTTGACTGGAAAAGGTAGTCGTCGGGAAGGCGCGGATGATGATGGTGTGGTGGTGGTGATGATGATGA
TGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[1:36:33] Кушелев Александр Юрьевич: Этот файл я взял отсюда: https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=fasta
[1:37:01] Кушелев Александр Юрьевич: Там можно взять dne-файл этого же белка: https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=genbank
[1:37:35] Кушелев Александр Юрьевич: Т.е. код var4 она сделала, а код var6 не хочет делать :)
[1:37:52] Кушелев Александр Юрьевич: Появлюсь минут через 20
[1:38:06] Va12220(valqwa): ага. как раз разберусь надеюсь
[1:38:25] Кушелев Александр Юрьевич: Кстати, программа Prosolver тоже не хочет работать именно с этим файлом и dne тоже!
[1:39:25] Va12220(valqwa): не страшно сейчас заработает. я ввел код 0
с ним разберусь и с этим тоже. 20 мин
[1:42:34] Va12220(valqwa): 1 - композитный код 0 я понимаю как останов счетчика так же как и с 2 и 3 - согласен ?
2 - далее я поступаю так же как было в случах 2 и 3 ? или тут особый случай?
в случаях 2 и 3 я меня предшествующие последоватеьлности на последовательности 5к и 4к
[1:46:36] Va12220(valqwa): полагаю тут то же самое.
[1:50:52] Va12220(valqwa): кстати в последнем фаста на 183 дкн группы аж!!! 41 включение Мет аминокислот
[1:56:57] Va12220(valqwa): и в "поправленном " алгоритме
отработало
[1:57:48] Va12220(valqwa): ет аминокислоты - это код 6 и фиолетовый кирпичег
[2:08:07] Кушелев Александр Юрьевич: ЗдОрово! Да. Просто сброс счётчика. А почему не работала прога на этом белке?
[2:08:53] Va12220(valqwa): не знаю. я же уже её передописал. она сейчас немного "лучше"
[2:08:53] Кушелев Александр Юрьевич: Там в фасте нужно убрать первый символ кода
[2:09:48] Кушелев Александр Юрьевич: >ENA|LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
AAGGCCAACAAGGCCGCCCGCACCCGTGATGTTTTCAACGACAAAGTTGATACCCATCTGCGTAGAAA
GTGCGCTGGTGACGTAACGCACTGCGATGTCTGAGGCGCTGCCGGCCTGCAAGGGGAGCCCCACGGTCAC
CGGATTGCCGAAGCTGTGTTTTTGAGCCATTGATAAACTGGGCCAAAAGGCGACGCCACAGGCTGCTGCG
CCTGCTTTGAGAAAGGTTCTTTTAATCATTAAGTCTCTCGCTGCCCACATTAGGGTCAAAATGTTTAACC
TTAGTATTTGAAATTTACTCTGTTTTTGAGATGATGTCACATGTCAAAATAAGGCTGACTAAATGGTCAA
ATGTTGACTGGAAAAGGTAGTCGTCGGGAAGGCGCGGATGATGATGGTGTGGTGGTGGTGATGATGATGA
TGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[2:10:43] Va12220(valqwa): зачем ?
[2:10:48] Кушелев Александр Юрьевич: Вот такой композиционный код выдала твои прога перед обломом:
[2:10:49] Кушелев Александр Юрьевич: 1,1,1,1,1,1,1,1,3,3,3,1,1,1,3,3,3,1,3,4,3,3,1,1,3,3,1,2,4,1,1,3,1,1,1,3,1,1,4,3,4,1,1,1,3,1,4,3,1,3,
3,4,3,1,1,3,1,1,3,4,2,3,1,1,1,2,1,1,1,1,1,3,1,3,3,3,3,3,3,1,1,3,1,1,2,3,1,3,3,3,3,1,3,1,3,1,3,3,3,4,
3,1,3,1,3,1,1,2,3,1,1,1,2,3,3,3,1,1,3,2,3,3,3,3,4,3,1,4,3,3,3,3,4,4,4,4,1,1,1,1,1,1,1,1,1,4,4,4,4,4,
4,4,4,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,
[2:11:15] Кушелев Александр Юрьевич: ммммм - это спираль из 11111
[2:12:00] Кушелев Александр Юрьевич: А, я не увидел конец картинки. Всё ОК
[2:12:08] Кушелев Александр Юрьевич: Давай программу :)
[2:12:21] Va12220(valqwa): TKD делаю.
[2:12:53] Кушелев Александр Юрьевич: ОК
[2:14:02] Кушелев Александр Юрьевич: И всё же непонятно, почему твоя прога и прога от Prosolver не работали на этом белке?
[2:20:30] Va12220(valqwa): основное время занимает в моей программе формирование картинки. её я формирую в памяти сначала программным образом, что "долго" с одной стороны и требует достаточно большого выделения именно динамической памяти как ты говорил. т.е. каждая операция меняет память.
[2:21:10] Va12220(valqwa): у меня пропадает при выводе строка с TDK обозначением. сейчас отыщу где "пропадает" поправлю и вышлю тебе
[2:23:26] Кушелев Александр Юрьевич: А нельзя динамическое выделение памяти поменять на статическое?
[2:23:56] Кушелев Александр Юрьевич: Быстродействие для меня очень важно...
[2:24:32] Va12220(valqwa): я думаю как это изменить
[2:31:33] Va12220(valqwa): с прерываниями поправил.
экспериментируй. алгоритм возможно не идеален
[2:31:45] Va12220(valqwa): сейчас перекину папочку
[2:33:58] Кушелев Александр Юрьевич: Благодарю!
[2:38:58] Кушелев Александр Юрьевич: А когда перекинешь-то?
[2:40:01] Va12220(valqwa): уже перекинул
[2:40:05] Кушелев Александр Юрьевич: Спасибо! Завтра утром займусь
[2:40:12] Кушелев Александр Юрьевич: Спокойной ночи!
[2:40:34] Va12220(valqwa): Ночи. я пока что DNE "добавлю"
[2:41:18] Va12220(valqwa): ты учти - что программа перебирает и обрабатывает подряд все файлы в папке.
если что-то обработал и тебе это уже не нужно - выноси из папки
[2:41:29] Кушелев Александр Юрьевич: ОК
[2:41:31] Va12220(valqwa): а то сутками можешь пересчитывать посчитанное
[4:56:23] Va12220(valqwa): этот релиз может читать и дне (embl) формат
обрати внимание на то , как этот формат EMBL представляется.
я приложил 2 файла fasta и один embl.
данный embl скачивал непосредственно с сайта, который ты мне указал.

если запустить данную программу, поместив внутри несколько файлов (как в данной папочке)
то они все три (их там 3) просчитаются по очереди
сначала файлы fasta
затем embl
[4:58:14] Va12220(valqwa): у меня все эти 3 файлика вместе просчитываются за время менее 20 секунд
[5:01:20] Va12220(valqwa): а точнее
Elapsed time is 11.341182 seconds.
[9:03:52] Кушелев Александр Юрьевич: Круто! Благодарю! Сейчас буду пробовать.
[9:06:25] Кушелев Александр Юрьевич: Запустил в 9:05
[9:07:21] Кушелев Александр Юрьевич: 9:07 два файла посчиталось с картинками
[9:09:26] Кушелев Александр Юрьевич: Вероятно и третий тоже. Я его не заметил, т.к. он очень широкую и короткую картинку сделал.
[9:10:44] Кушелев Александр Юрьевич: А этот у тебя сколько секунд считается?
[9:11:28] Кушелев Александр Юрьевич: И особенно этот: https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=genbank
[9:11:45] Кушелев Александр Юрьевич: У меня полчаса
[9:37:50] Кушелев Александр Юрьевич: Вот такой файл не хочет считаться:
[9:37:51] Кушелев Александр Юрьевич: >LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
GATGATGGTGTGGTGGTGGTGATGATGATGA
TGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[9:39:26] Кушелев Александр Юрьевич: Выравнивание строк не спасает:
[9:39:27] Кушелев Александр Юрьевич: >LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
GATGATGGTGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGACGGTGGTGGTG
GTGGTGGTGGTGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATG
ATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[9:44:31] Кушелев Александр Юрьевич: Вот с этим файлом считать не хочет
[9:47:21] Кушелев Александр Юрьевич: Изменение числа символов в строке не помогает
[9:54:55] Кушелев Александр Юрьевич: Вроде считает, но уже больше двух минут. А там файл-то маленький...
[9:56:39] Кушелев Александр Юрьевич: 4 минуты прошло. Даже коды не выводит.
[10:00:45] Кушелев Александр Юрьевич: А, там была ошибка в CDS
[10:01:15] Кушелев Александр Юрьевич: Нужно будет контроль входных данных делать...
[10:02:54] Кушелев Александр Юрьевич: Всё равно не работает с этим файлом.
[10:03:08] Кушелев Александр Юрьевич: И никакого сообщения диагностического не выдаётся
[10:52:37] Va12220(valqwa): по поводу ДНЕ - ты скорее всего, как я понимаю выцепляешь последовательность методом "скопировать выделенное" с сайта и это скопированное поместить в файл, который ты сам и создал

я специально тебе сказал - есть правила формирования формата - файл должен быть сформирован по этому правилу.

я ведь не копирую файлы дне а "скачиваю" с сайта как файлы.

m30_dne.dne
как называется этот белок ?
ссылка на сайте ?
[10:58:05] Кушелев Александр Юрьевич: Тут дело не в формате.
[10:58:24] Кушелев Александр Юрьевич: Достаточно добавить или убавить один символ в последовательности, и программа начинает работать
[10:58:36] Кушелев Александр Юрьевич: Тут дело именно в комбинации символов входного кода
[10:59:47] Кушелев Александр Юрьевич: Со сдвинутой рамкой считывания на 1 и на 2 символа программа работает. Кстати, у Prosolver та же ситуация ...
[11:00:15] Кушелев Александр Юрьевич: А со сдвигом на 0, 3, 6, 9 символов программы (обе!) отказываются считать.
[12:11:13] Va12220(valqwa): сейчас посмотрю в чем дело (изнутри)
[12:13:04] Кушелев Александр Юрьевич: ОК
[12:15:23] Va12220(valqwa): последняя картинка это твой файл m30_dne ?
[12:20:33] Кушелев Александр Юрьевич: Программа должна выдать это:

Изображение
[12:20:51] Va12220(valqwa): последняя картинка это твой файл m30_dne ?
[12:24:33] Кушелев Александр Юрьевич: Вот что говорит программа от Prosolver на этот файл:

Изображение

А это сообщение твоей программы:

Изображение

[12:24:42] Кушелев Александр Юрьевич: Твоя тоже ругается и ничего не делает.
[12:25:37] Кушелев Александр Юрьевич: Любопытно, что всю структуру целиком твоя программа показала :)
[12:25:42] Va12220(valqwa): Саша, эта последовательность есть на сайте ?
https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=genbank
[12:25:55] Кушелев Александр Юрьевич:

Изображение
[12:26:09] Кушелев Александр Юрьевич: Это кусок последовательности
[12:26:38] Кушелев Александр Юрьевич: Целую последовательность программа обрабатывает корректно
[12:26:56] Кушелев Александр Юрьевич: А обрезанную не хочет
[12:27:26] Va12220(valqwa): ясно. то ты сам сгенерил файл. из последовательности.
значит ты неправильно сгенерил эту последовательность. мне тут сложно тебе помочь. я увы правил генерации, и правил правильного вырезания кусков - не знаю
[12:27:42] Va12220(valqwa): ссулку на целую последовательность дай
[12:28:03] Кушелев Александр Юрьевич: Я не мог её неправильно сгенерировать, т.к. все последовательности должны обрабатываться по нашему алгоритму без исключения
[12:29:43] Кушелев Александр Юрьевич: >ENA|LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
AAGGCCAACAAGGCCGCCCGCACCCGTGATGTTTTCAACGACAAAGTTGATACCCATCTGCGTAGAAA
GTGCGCTGGTGACGTAACGCACTGCGATGTCTGAGGCGCTGCCGGCCTGCAAGGGGAGCCCCACGGTCAC
CGGATTGCCGAAGCTGTGTTTTTGAGCCATTGATAAACTGGGCCAAAAGGCGACGCCACAGGCTGCTGCG
CCTGCTTTGAGAAAGGTTCTTTTAATCATTAAGTCTCTCGCTGCCCACATTAGGGTCAAAATGTTTAACC
TTAGTATTTGAAATTTACTCTGTTTTTGAGATGATGTCACATGTCAAAATAAGGCTGACTAAATGGTCAA
ATGTTGACTGGAAAAGGTAGTCGTCGGGAAGGCGCGGATGATGATGGTGTGGTGGTGGTGATGATGATGA
TGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[12:30:28] Кушелев Александр Юрьевич: Вот сайт: https://www.ncbi.nlm.nih.gov/nuccore/1039188734
[12:31:30] Кушелев Александр Юрьевич: Любая комбинация символов ACGT... должна отрабатываться программой
[12:31:54] Va12220(valqwa): ты намешал кучу. начал с дне а заканчиваешь фастой.
зря я тебе сделал обработку embl файла. ты только сам запутался и ещё путаешь и меня (и наверное все остальных)

поэтому давай ограничимся пока что фастой, поскольку ты физически неверно задаёшь структуру embl файла, когда делаешь это саморучно (так называемый "новодел Кушелева" однозначно неверен по формату). Отсюда и все пауки в твоей голове.
[12:33:21] Кушелев Александр Юрьевич: Нет. На сайте есть и dne-файл: https://www.ncbi.nlm.nih.gov/nuccore/1039188734
и фаста: https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=fasta
[12:33:30] Кушелев Александр Юрьевич: Я оба варианта проверял.
[12:33:55] Кушелев Александр Юрьевич: Если сдвинуть начало белка на один или два символа, то программа работает и выдаёт правильные результаты:
[12:34:57] Va12220(valqwa): я тебе верю. но на всякий случай скачал аналог embl твоей ссылки в ПРАВИЛЬНОМ виде
[12:36:10] Кушелев Александр Юрьевич: Обе программы, т.е. и от Prosolver, и твоя отказываются обрабатывать только один из трёх вариантов последовательности, когда должна получиться такая картинка:

Изображение
[12:38:16] Va12220(valqwa): не суетись.ю разбираемся дальше.
правильно скачанный файл я обработал и получил следующе:
смотри выше
[12:38:19] Кушелев Александр Юрьевич: Это со сдвигом на один или два символа
[12:38:29] Va12220(valqwa): теперь скажи что ты такое с этим файлом сделал
[12:38:49] Va12220(valqwa): нет. это без сдвигов. это вот так как эта последовательность записана на сайте
[12:39:04] Кушелев Александр Юрьевич: При убирании одного символа кода картинка должна радикально измениться. Другие аминокислотные остатки получатся
[12:39:18] Кушелев Александр Юрьевич: При убирании второго (от начала) символа ещё раз
[12:39:23] Va12220(valqwa): например какой символ (код ) ты убрал
[12:39:51] Кушелев Александр Юрьевич: А если третий символ убрать, то уберётся первый аминокислотный остаток по сравнению с тем, где на три символа было больше
[12:40:07] Va12220(valqwa): успокойся.
[12:40:12] Кушелев Александр Юрьевич: TCAAGGCCAACAAGGCCGCCCGCACCCGTGATGTTTTCAACGACAAAGTTGATACCCATCTGCGTAGAAA
GTGCGCTGGTGACGTAACGCACTGCGATGTCTGAGGCGCTGCCGGCCTGCAAGGGGAGCCCCACGGTCAC
CGGATTGCCGAAGCTGTGTTTTTGAGCCATTGATAAACTGGGCCAAAAGGCGACGCCACAGGCTGCTGCG
CCTGCTTTGAGAAAGGTTCTTTTAATCATTAAGTCTCTCGCTGCCCACATTAGGGTCAAAATGTTTAACC
TTAGTATTTGAAATTTACTCTGTTTTTGAGATGATGTCACATGTCAAAATAAGGCTGACTAAATGGTCAA
ATGTTGACTGGAAAAGGTAGTCGTCGGGAAGGCGCGGATGATGATGGTGTGGTGGTGGTGATGATGATGA
TGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[12:40:15] Va12220(valqwa): ещё раз. какой символ убрать ?
[12:40:24] Кушелев Александр Юрьевич: Первый символ T
[12:40:53] Кушелев Александр Юрьевич: А кто тебе сказал, что я не спокоен?
[12:41:32] Va12220(valqwa): суетишься. не можешь остановиться.

т.е. если убрать в первом рядочке последовательности
tcaaggccaa caaggccgcc cgcacccgtg atgttttcaa cgacaaagtt gatacccatc
симовл t
то получится строка
caaggccaa caaggccgcc cgcacccgtg atgttttcaa cgacaaagtt gatacccatc
и далее все остальное. верно ?
[12:41:47] Кушелев Александр Юрьевич: Да
[12:42:07] Va12220(valqwa): и вот при убранном t программа перестает работать
так ?
[12:42:09] Кушелев Александр Юрьевич: А в следующий раз убирай ещё один символ. Должна получиться третья картинка
[12:42:26] Кушелев Александр Юрьевич: Программа работает в двух вариантах из трёх
[12:42:38] Va12220(valqwa): и вот при убранном t программа перестает работать
так ?
[12:42:55] Va12220(valqwa): ты ответь на вопрос. потом остальное напишешь. если надо будет
[12:42:56] Кушелев Александр Юрьевич: Либо так, либо ещё один символ нужно убрать
[12:43:15] Кушелев Александр Юрьевич: Я не могу держать в голове последовательность символов :)
[12:43:44] Va12220(valqwa): ещё раз.
спрашиваю.
если в последовательности убрать первый символ t
ПРОГРАММА РАБОТАТЬ ОТКАЗЫВАЕТСЯ???
один только символ убрать. мой вопрос непонятен?
[12:44:04] Кушелев Александр Юрьевич: Для ответа мне придётся ещё раз запускать твою прогу
[12:44:10] Кушелев Александр Юрьевич: Я не помню, один или два
[12:44:30] Va12220(valqwa): но sn при этом не написал статью целую уже. вместо того чо бы ответить на вопрос.
[12:44:41] Кушелев Александр Юрьевич: Жди
[12:45:23] Va12220(valqwa): отвечаю за тебя - не будет работать.
объясняю почему
[12:46:40] Va12220(valqwa): потому что твой алгоритм преобразования аминокислотной цепочки рассчитан на обработку последовательностей из 3х "буквочек"
т.е. количество "буквочек" в цепочке должно быть кратно трем
как олько ты убираешь однку буквочку - кратность трем нарушается.
[12:48:01] Кушелев Александр Юрьевич: В программе от Prosolver выдаётся сообщение "не кратно трём" и последние две или один символ последовательности игнорируются
[12:48:09] Кушелев Александр Юрьевич: У тебя тоже так вроде было
[12:48:38] Va12220(valqwa): ну извини, ты меня не предупреждал, что ты будешь делать "новоделы Кушелева"
[12:49:04] Va12220(valqwa): хотя ограничение я вроде бы на условие кратности поставил по умолчанию
[12:49:27] Кушелев Александр Юрьевич: Так в файле fasta кратности нет.
[12:49:48] Кушелев Александр Юрьевич: А в файле dne кратность должна быть указана в CDS
[12:50:08] Кушелев Александр Юрьевич: Выдавать сообщение о некратности не обязательно
[12:51:16] Va12220(valqwa): А в файле dne кратность должна быть указана в CDS

не вижу

посмотри посл файл embl и скажи какая кратность там в CDS
[12:51:37] Кушелев Александр Юрьевич: Вот этот файл не отрабатывается: >LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
AAGGCCAACAAGGCCGCCCGCACCCGTGATGTTTTCAACGACAAAGTTGATACCCATCTGCGTAGAAA
GTGCGCTGGTGACGTAACGCACTGCGATGTCTGAGGCGCTGCCGGCCTGCAAGGGGAGCCCCACGGTCAC
CGGATTGCCGAAGCTGTGTTTTTGAGCCATTGATAAACTGGGCCAAAAGGCGACGCCACAGGCTGCTGCG
CCTGCTTTGAGAAAGGTTCTTTTAATCATTAAGTCTCTCGCTGCCCACATTAGGGTCAAAATGTTTAACC
TTAGTATTTGAAATTTACTCTGTTTTTGAGATGATGTCACATGTCAAAATAAGGCTGACTAAATGGTCAA
ATGTTGACTGGAAAAGGTAGTCGTCGGGAAGGCGCGGATGATGATGGTGTGGTGGTGGTGATGATGATGA
TGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[12:52:26] Va12220(valqwa): это фаста без первых 2х символов ?
[12:52:57] Va12220(valqwa): сейчас проверю
[12:53:14] Кушелев Александр Юрьевич: microb_0 и microb_1 отрабатываются корректно, а microb_2 только код-4 выдаётся, а код-6 уже не выдаётся и картинка тоже
[12:54:26] Кушелев Александр Юрьевич: Да, без двух первых символов. Но если уберёшь ещё 3 или 3 добавишь, то всё-равно не работает. А если добавить или убрать не кратно 3, то будет работать.
[12:55:17] Кушелев Александр Юрьевич: Самое загадочное, что у Prosolver та же ситуация
[12:55:44] Кушелев Александр Юрьевич: Ты вчера уже исправлял. Целый файл у тебя стал работать
[12:55:53] Va12220(valqwa): погоди проверяю.

и так первый microb_0 - работает корректно - это неизмененная цепочка с сайта
[12:55:55] Кушелев Александр Юрьевич: А обрезанный кусок не хочет
[12:56:28] Кушелев Александр Юрьевич: Да, но это не последовательность реального белка. Это "со сбитой рамкой настройки"
[12:56:43] Кушелев Александр Юрьевич: Реальный белок кодируется как раз без двух первых символов
[12:58:57] Кушелев Александр Юрьевич: Вот последовательность аминокислотных остатков реального белка: /translation="MLTGKGSRREGADDDGVVVVMMMMMMMMMTVVVVVVVMMMMMMM
MMMMMMMMMMMMMMMMMMMMMMM"
[12:59:00] Va12220(valqwa): я понимаю. "новодел Кушелева" )
microb_1 - тут убран 1й символ. (вообще то говоря и вся структура как бы полностью меняется, поскольку кодовые тройки абсолютно иными становятся.)
ПОСЧИТАЛОСЬ (6 сек)
[12:59:13] Кушелев Александр Юрьевич: Взято с сайта: https://www.ncbi.nlm.nih.gov/nuccore/1039188734
[12:59:42] Va12220(valqwa): сейчас посмотрим что происходит если убрать первые 2 символа
микро_2
[13:00:01] Кушелев Александр Юрьевич: Да. Без одного символа считается корректно. Но со всеми символами и без одного символа - это не коды реального белка.
[13:00:12] Кушелев Александр Юрьевич: Код реального белка - без двух символов
[13:00:31] Va12220(valqwa): сек. смотрю
[13:05:37] Кушелев Александр Юрьевич: А потом интересно узнать, сколько секунд у тебя будет отрабатываться этот файл: https://www.ncbi.nlm.nih.gov/nuccore/614458216
[13:07:50] Кушелев Александр Юрьевич: Кстати, в DNE-файле рамка не сбита: https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=genbank
[13:13:38] Va12220(valqwa): меняю отсекание "лишнего" остатка при приверке. сек
[13:36:34] Va12220(valqwa): смотри в данном новоделе Кушелева последний триплекс - ATG
в этом случае "включается" проверка - какой же сл символ - а сл символа то нет - поэтому и сбоит программа. сейчас поменяю условия проверки. в случае если это конец цепочки
[13:37:46] Кушелев Александр Юрьевич: Ура! Вероятно у Prosolver то же было
[13:39:32] Va12220(valqwa): последний Мет менять на 1 или 6-ку код ?
[13:40:04] Кушелев Александр Юрьевич: На "1"
[13:41:15] Кушелев Александр Юрьевич: Появлюсь через часа полтора
[14:13:00] Va12220(valqwa): лови. исправил. вроде бы "новодел" кушелева" теперь работает
[14:26:31] Va12220(valqwa): да. посчиталось быстро 4 и 6 коды. а вот картинка все ещё строится (((
это не есть хорошо. буду сейчас думать как ускорить этот процесс
всего 16179 кодов в этой последовательности
а это получается изоражение размером 300(ширина) на 320000(высота) пикселов
[14:59:34] Va12220(valqwa): Elapsed time is 2426.533488 seconds. или 40 минут

практически 40 минут и строило изображение ..... жуть
[15:26:44] Кушелев Александр Юрьевич: ЗдОрово! А этот "новодел" тоже работает?
https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=genbank
[15:32:07] Кушелев Александр Юрьевич: 15:28 ... 15:29 - "новодел" посчитался и вывелась картинка за 1 минуту. Уже неплохо.
[15:33:43] Кушелев Александр Юрьевич: У тебя 40 минут и у меня где-то столько же. А ты уже заменил динамические массивы на статические?
[15:34:07] Va12220(valqwa): нет. с графикой пока что разбираюсь как ускорить.
[15:36:05] Кушелев Александр Юрьевич: Ну так там, вероятно, тоже массивы динамические
[15:46:48] Кушелев Александр Юрьевич: "Новодел Кушелева" на моём компьютере считается меньше минуты по этому коду:
[15:47:08] Кушелев Александр Юрьевич: >LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
CTAAATGGTCAAATGTTGACTGGAAAAGGTAGTCGTCGGGAAGGCGCGGATGATGATGGTGTGGTGGTGG
TGATGATGATGATGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATG
ATGA
Изображение
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Вернуться в Уголок Кушелева

Кто сейчас на форуме (по активности за 5 минут)

Сейчас этот раздел просматривают: 1 гость

cron