Открыт новый тип белковой структуры!

Список разделов Альтернативная Физика Уголок Кушелева

Модератор: Kushelev

Сообщение #1 Kushelev » 17.01.2017, 18:57

Формы, механизмы, энергия наномира. Сообщение 84 575

Пикотехнология белков, ДНК, РНК - 2

Открыт новый тип белковой структуры!

http://nanoworld.org.ru/post/82432/#p82432

>NM_207361.5 Homo sapiens FRAS1 related extracellular matrix protein 2 (FREM2), mRNA
GGGATTTCCCTCAAAGCCCAGGGTCCGGGGACCTGGAAAGTAGAAGTGGAGGGATTCAATTCTCCGCGCG
ATTGAGGCGCTAGCGGCGGAGCTGGACGGCCTGGGAAGGCTTCGGCTCCTCGGCTGCGGCTCCAGCCCGG
ACGGCGCCGCGCAACTTTGCCATCCTTCTGGCCCAGCCCCGGCTACAGGAGGACCCCGCGGGCAACGCGC
GGAGTTCCTGGCACTTCCCGGCGGTGTCTCTTGTTGTCTGCCCGGGGACCGACTTCGCATGCTCTCAGGC
TGACCTGTCCAAGCCCGAACACCGGGACCATGCACTCAGCCGGGACTCCCGGGTTATCCTCGCGCCGGAC
AGGCAACTCCACCAGCTTTCAACCAGGACCGCCACCGCCGCCCCGGCTGCTGCTGCTGCTGCTGCTTCTC
CTGTCACTGGTAAGCCGCGTCCCGGCACAGCCCGCTGCCTTCGGCAGGGCGTTGCTGTCCCCTGGTCTCG
CGGGGGCTGCAGGGGTCCCTGCTGAGGAGGCCATAGTGCTGGCGAACCGCGGACTCCGGGTGCCTTTCGG
CCGTGAAGTCTGGCTGGATCCCCTGCATGACCTGGTGTTGCAGGTGCAGCCCGGGGACCGCTGCGCGGTT
TCGGTACTAGACAACGACGCACTGGCCCAGCGACCGGGCCGCCTGAGTCCCAAGCGCTTCCCGTGCGACT
TTGGCCCTGGCGAGGTGCGCTACTCTCACCTGGGCGCGCGCAGCCCGTCTCGGGACCGCGTCCGGCTGCA
GCTGCGCTATGACGCGCCCGGAGGGGCAGTAGTGCTACCACTGGTACTGGAGGTGGAGGTGGTCTTCACC
CAGCTGGAGGTTGTGACTCGGAACTTGCCTCTGGTCGTGGAAGAGCTGCTGGGGACCAGCAATGCCCTGG
ACGCGCGGAGCCTGGAGTTCGCCTTCCAGCCCGAGACAGAGGAGTGCCGCGTGGGCATCCTGTCCGGCTT
GGGCGCGCTGCCTCGCTATGGAGAACTCCTCCACTACCCGCAGGTCCCTGGAGGAGCCAGAGAGGGAGGC
GCCCCGGAGACTCTCCTGATGGACTGCAAAGCTTTCCAGGAACTAGGCGTGCGCTATCGCCACACAGCCG
CCAGTCGCTCACCAAACAGGGACTGGATACCCATGGTGGTGGAGCTGCGTTCACGAGGGGCTCCTGTGGG
CAGCCCTGCTTTGAAACGCGAGCACTTCCAGGTTCTGGTGAGGATCCGAGGAGGGGCCGAGAACACTGCA
CCCAAGCCCAGTTTCGTGGCCATGATGATGATGGAGGTGGACCAGTTTGTACTGACGGCCCTGACCCCAG
ACATGCTGGCAGCCGAGGATGCTGAGTCTCCCTCTGACCTGTTGATCTTCAACCTTACTTCTCCATTCCA
GCCTGGCCAGGGCTACTTGGTGAGCACCGATGATCGCAGCCTGCCCCTTTCCTCCTTCACTCAGAGGGAT
CTGCGGCTCCTGAAGATTGCCTACCAGCCCCCTTCTGAAGACTCTGACCAGGAGCGCCTCTTTGAACTGG
AATTGGAGGTAGTGGATCTAGAAGGAGCAGCTTCAGACCCTTTTGCCTTCATGGTAGTGGTGAAGCCCAT
GAACACAATGGCTCCGGTGGTCACCCGGAATACCGGTCTTATTCTCTATGAGGGTCAGTCTCGGCCCCTC
ACAGGCCCTGCAGGCAGTGGTCCGCAAAACTTGGTCATCAGCGATGAGGATGACCTAGAAGCAGTGCGGC
TAGAGGTGGTGGCTGGGCTCCGGCATGGTCACCTTGTCATTCTGGGTGCTTCCAGTGGCAGCTCTGCTCC
CAAGAGCTTTACAGTGGCTGAGCTGGCAGCCGGCCAGGTGGTCTACCAGCATGATGACAGAGACGGCTCG
CTGAGCGACAACCTGGTGCTTCGCATGGTGGATGGAGGAGGCAGGCACCAGGTACAGTTTCTGTTCCCCA
TCACCTTAGTGCCTGTGGATGACCAGCCACCTGTTCTCAATGCCAACACGGGGCTGACACTGGCAGAGGG
TGAAACAGTGCCCATCCTGCCCCTTTCCCTGAGTGCAACTGACATGGATTCAGATGATTCTCTGCTGCTT
TTTGTGCTGGAGTCACCCTTCTTAACTACGGGGCATCTGCTTCTCCGCCAAACTCACCCTCCCCATGAGA
AGCAGGAACTTCTCAGAGGCCTTTGGAGGAAGGAGGGGGCATTTTATGAGCGAACAGTGACAGAGTGGCA
GCAGCAGGACATAACAGAGGGCAGGCTGTTCTATAGACACTCTGGGCCCCATAGTCCTGGGCCAGTCACA
GACCAGTTCACATTTAGAGTCCAGGATAACCATGACCCTCCTAATCAGTCCGGGCTACAGCGGTTTGTGA
TTCGTATCCATCCTGTGGATCGCCTCCCTCCGGAGCTGGGCAGTGGCTGTCCCCTTCGTATGGTGGTACA
GGAATCCCAGCTCACACCACTGAGGAAGAAGTGGCTGCGCTACACTGACCTGGACACAGATGACCGAGAA
CTACGTTACACAGTGACTCAGCCCCCCACAGACACAGACGAAAATCACCTGCCAGCCCCACTGGGTACCT
TGGTCTTGACTGACAACCCCTCAGTCGTGGTGACCCATTTTACCCAAGCCCAGATCAACCATCATAAAAT
TGCTTACAGACCCCCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTTCCAGTTCCAGGTGGAA
GACCGAGCTGGGAATGTGGCTCCAGGTACCTTTACCCTTTACTTGCATCCCGTGGACAACCAGCCACCTG
AGATCCTCAACACCGGCTTCACTATTCAGGAGAAGGGTCACCACATCCTGAGTGAGACAGAGTTGCACGT
GAATGATGTAGACACTGATGTTGCCCATATCTCTTTCACTCTCACTCAGGCACCCAAACATGGCCACATG
AGAGTGTCTGGACAGATCCTGCATGTAGGGGGTCTCTTCCACTTGGAGGACATAAAACAGGGCCGAGTTT
CCTATGCCCATAATGGGGACAAGTCCCTGACTGATAGCTGCTCCTTGGAAGTCAGTGACAGACATCATGT
GGTGCCCATCACTCTCAGAGTAAATGTCCGGCCAGTGGATGATGAAGTGCCCATACTGAGCCATCCTACT
GGCACTCTGGAGTCCTATCTAGATGTCTTAGAAAATGGGGCTACTGAAATCACTGCCAATGTTATTAAGG
GGACCAATGAGGAAACTGATGACTTGATGTTGACTTTCCTCTTGGAAGATCCACCTTTGTATGGGGAAAT
CTTGGTCAATGGCATTCCAGCAGAGCAGTTTACTCAAAGGGACATCTTGGAGGGCTCTGTTGTATATACC
CACACCAGTGGTGAGATAGGCCTATTGCCTAAAGCGGATTCTTTTAACCTGAGTCTGTCAGATATGTCTC
AAGAATGGAGAATTGGTGGCAATACTATCCAAGGAGTTACTATATGGGTGACCATCCTGCCTGTTGATAG
CCAGGCCCCAGAAATCTTTGTAGGTGAACAGTTGATAGTAATGGAAGGTGATAAAAGTGTTATAACATCA
GTGCATATAAGTGCTGAAGATGTCGACTCCCTGAATGATGACATCTTGTGCACTATAGTTATTCAGCCTA
CTTCAGGTTATGTTGAAAACATTTCTCCAGCACCAGGCTCTGAGAAATCAAGAGCAGGGATTGCCATAAG
TGCTTTCAACTTGAAAGATCTCAGGCAGGGCCACATAAACTATGTCCAGAGTGTCCATAAAGGGGTGGAA
CCTGTGGAGGACCGATTTGTATTTCGTTGTTCTGATGGCATTAACTTTTCAGAGAGACAGTTCTTCCCCA
TTGTAATCATTCCCACCAATGATGAACAGCCAGAGATGTTTATGAGAGAATTTATGGTGATGGAAGGCAT
GAGTCTGGTAATTGATACACCCATTCTCAATGCTGCTGATGCTGATGTTCCCCTGGATGATTTAACTTTC
ACTATTACCCAATTCCCCACTCATGGTCACATCATGAATCAGCTGATAAATGGCACGGTTTTGGTCGAAA
GCTTCACCTTGGATCAGATCATAGAGAGTTCCAGCATTATTTATGAGCATGATGACTCCGAGACCCAGGA
AGACAGTTTTGTGATTAAACTAACAGATGGGAAGCACTCTGTGGAAAAGACGGTCCTCATTATAGTTATC
CCTGTTGATGATGAGACGCCCAGAATGACTATCAATAATGGACTAGAAATAGAAATTGGGGATACCAAGA
TTATCAACAACAAAATATTAATGGCAACAGATTTAGATTCAGAAGACAAATCTTTGGTTTATATTATTCG
TTATGGGCCAGGACATGGCTTATTACAGAGACGAAAACCTACTGGTGCCTTTGAAAATATCACACTGGGC
ATGAATTTTACCCAGGATGAAGTAGACAGAAACTTAATTCAGTATGTCCATTTGGGGCAAGAGGGCATTC
GGGACCTAATTAAATTTGATGTGACTGATGGAATAAATCCCCTCATAGATCGTTACTTTTATGTGTCCAT
CGGGAGCATTGACATTGTCTTCCCTGATGTGATAAGTAAGGGAGTGTCCTTGAAAGAAGGTGGCAAAGTC
ACTCTTACAACAGACCTACTAAGCACTAGTGACTTGAACAGTCCTGATGAAAACTTGGTTTTTACCATCA
CCAGGGCTCCCATGCGAGGTCACCTGGAATGCACGGATCAGCCTGGTGTGTCCATCACGTCTTTCACTCA
GCTGCAACTGGCTGGAAACAAAATCTACTACATCCACACAGCTGATGATGAAGTGAAAATGGACAGTTTT
GAGTTTCAAGTCACCGATGGACGTAACCCTGTCTTTCGGACATTCCGTATCTCCATTAGCGATGTGGACA
ATAAAAAGCCAGTGGTCACCATCCACAAGCTGGTTGTCAGTGAAAGTGAAAACAAGCTGATTACTCCTTT
TGAGCTCACTGTCGAAGACAGAGATACTCCTGACAAGCTCCTGAAATTCACTATCACCCAGGTGCCTATT
CATGGCCATCTCCTATTCAACAATACCAGACCTGTCATGGTTTTTACCAAGCAAGACTTGAATGAAAACT
TAATCAGCTACAAACATGATGGCACTGAGTCAAGTGAAGATAGCTTCTCCTTCACAGTGACTGATGGCAC
CCATACAGACTTCTATGTTTTTCCTGATACGGTGTTTGAAACAAGGAGACCCCAAGTGATGAAGATCCAG
GTCTTGGCTGTTGACAACAGTGTCCCCCAAATCGCAGTGAATAAGGGGGCCTCTACACTTCGCACTCTAG
CCACTGGCCACTTGGGGTTCATGATCACAAGCAAAATATTGAAAGTGGAGGACAGAGACAGCTTACACAT
TTCTCTTAGATTTATCGTGACAGAGGCCCCTCAACATGGATATCTTCTCAACCTGGACAAAGGCAACCAC
AGCATCACTCAGTTCACACAAGCTGACATTGATGACATGAAAATATGCTATGTCTTAAGAGAAGGGGCTA
ATGCCACAAGTGATATGTTCTATTTTGCAGTTGAAGATGGTGGTGGAAACAAGTTAACGTACCAGAATTT
TCGTCTGAATTGGGCATGGATCTCCTTTGAAAAGGAATATTACCTGGTCAATGAGGACTCCAAATTTCTA
GATGTTGTTCTTAAACGTAGAGGTTACTTGGGAGAAACTTCTTTTATAAGTATTGGCACAAGAGACAGAA
CTGCAGAAAAAGACAAAGACTTCAAGGGCAAAGCACAGAAACAAGTGCAGTTCAACCCAGGCCAGACCAG
GGCCACATGGCGAGTGCGGATCCTGAGTGATGGGGAGCATGAGCAGTCTGAAACCTTTCAGGTGGTACTC
TCAGAGCCCGTGCTGGCTGCCTTGGAATTCCCCACAGTCGCCACTGTTGAGATCGTTGATCCAGGAGATG
AGCCAACTGTGTTTATTCCCCAGTCCAAATACTCCGTTGAAGAAGATGTTGGTGAGCTGTTCATTCCCAT
CAGGAGGAGCGGAGATGTGAGCCAGGAGTTGATGGTGGTCTGTTATACCCAACAAGGAACAGCAACTGGA
ACTGTGCCGACTTCCGTGTTGTCTTACTCTGATTACATATCCAGGCCTGAGGACCACACCAGTGTTGTCC
GCTTTGACAAAGATGAACGGGAGAAACTGTGTCGGATAGTCATAATTGATGACTCTTTGTACGAGGAGGA
GGAAACCTTCCATGTCCTTCTGAGCATGCCCATGGGGGGAAGAATCGGATCAGAGTTCCCAGGGGCTCAA
GTTACAATCGTTCCTGACAAAGATGATGAACCCATCTTTTACTTCGGTGATGTGGAATACTCTGTGGATG
AGAGTGCTGGCTATGTGGAAGTGCAGGTGTGGAGAACGGGCACTGACCTGTCCAAGTCTTCTAGTGTCAC
AGTGAGGTCTCGGAAAACAGATCCTCCCTCTGCAGATGCTGGAACAGACTATGTGGGCATCAGCCGTAAT
TTAGATTTTGCACCTGGAGTCAACATGCAGCCTGTTCGTGTTGTCATTCTGGATGACCTTGGACAACCAG
CGCTGGAGGGAATTGAGAAATTTGAACTGGTGCTTCGCATGCCTATGAACGCAGCCCTTGGCGAGCCCAG
CAAAGCCACAGTGTCCATAAATGACTCTGTCTCCGATTTGCCTAAGATGCAATTCAAAGAACGAATATAT
ACTGGCAGCGAAAGTGATGGGCAGATAGTTACAATGATCCATAGGACTGGGGATGTCCAGTACAGATCTT
CAGTGAGATGCTACACCCGGCAGGGGTCTGCACAGGTGATGATGGACTTTGAAGAACGCCCAAACACTGA
TACCTCCATCATCACATTCCTCCCTGGTGAGACAGAAAAGCCCTGCATTCTTGAGCTGATGGACGATGTG
CTCTATGAGGAGGTAGAGGAGCTCCGCCTGGTACTCGGCACTCCACAAAGCAACTCTCCCTTTGGGGCTG
CAGTTGGTGAACAAAATGAAACTCTCATAAGGATCCGAGATGATGCTGATAAGACTGTTATTAAATTTGG
AGAAACCAAATTTAGTGTCACTGAACCCAAAGAACCTGGAGAGTCGGTGGTTATAAGAATTCCAGTGATT
CGCCAAGGAGACACTTCAAAGGTTTCCATTGTGAGAGTCCACACCAAGGATGGCTCGGCCACCTCTGGAG
AAGACTACCACCCTGTGTCAGAAGAAATTGAGTTTAAGGAAGGGGAAACCCAGCACGTGGTTGAAATCGA
AGTTACCTTTGACGGGGTGAGAGAGATGAGAGAGGCCTTCACTGTTCACCTAAAACCTGATGAAAATATG
ATAGCAGAGATGCAGTTGACGAAAGCCATTGTGTACATAGAAGAAATGAGCAGCATGGCAGATGTCACTT
TTCCTTCTGTCCCTCAAATTGTATCCCTGTTGATGTATGACGACACTTCCAAAGCTAAGGAGAGTGCTGA
ACCCATGTCTGGCTATCCTGTCATCTGTATCACAGCTTGCAACCCCAAATATTCAGACTACGATAAAACA
GGCTCTATCTGTGCAAGTGAGAACATCAATGACACTTTGACGCGGTACCGGTGGCTGATTAGTGCACCTG
CGGGCCCTGACGGTGTGACCAGCCCTATGAGAGAAGTGGACTTCGACACCTTTTTTACGTCATCCAAGAT
GGTCACACTGGACTCCATATACTTTCAGCCTGGCTCCCGGGTACAGTGCGCAGCTCGTGCTGTGAACACC
AATGGGGATGAAGGCCTGGAGCTCATGAGCCCTATTGTAACCATCAGCAGAGAAGAAGGTCTTTGTCAGC
CCCGTGTACCTGGGGTTGTTGGAGCAGAGCCGTTCTCAGCTAAATTGCGCTACACAGGCCCTGAGGATGC
AGACTACACAAACCTTATCAAGCTCACTGTCACAATGCCACACATAGATGGCATGCTCCCCGTGATCTCC
ACTAGAGAGCTTTCCAACTTTGAGCTCACCCTCAGCCCTGATGGCACAAGAGTTGGAAACCACAAGTGCT
CCAACCTCCTGGATTATACTGAAGTGAAGACTCATTATGGTTTCTTGACTGATGCTACCAAAAATCCAGA
AATAATTGGAGAGACATATCCTTACCAGTACAGCTTGTCCATCAGAGGTTCCACTACCTTGCGCTTCTAC
CGGAACCTGAACCTAGAGGCCTGTTTATGGGAGTTCGTTAGCTACTATGACATGTCAGAACTCCTTGCTG
ACTGTGGTGGCACCATTGGAACAGATGGACAGGTCCTAAACCTAGTGCAGTCCTATGTGACCCTTCGAGT
CCCTCTGTATGTTTCCTACGTGTTCCATTCCCCCGTGGGGGTAGGAGGCTGGCAGCATTTTGACTTGAAG
TCAGAGCTTCGTCTAACTTTTGTGTACGACACCGCCATCTTGTGGAATGATGGAATTGGCAGCCCCCCAG
AGGCTGAACTTCAAGGTTCTCTCTATCCAACCAGCATGCGCATCGGTGATGAGGGGCGCTTGGCCGTGCA
CTTCAAGACAGAGGCTCAGTTCCATGGCTTATTTGTGCTGTCACATCCCGCATCCTTTACAAGCTCAGTG
ATCATGTCAGCTGATCATCCAGGCCTGACATTTTCCCTCCGCCTCATAAGGAGTGAACCAACCTATAACC
AGCCAGTACAGCAGTGGAGCTTTGTCTCTGACTTTGCCGTACGTGACTACTCAGGGACCTATACTGTGAA
GCTGGTGCCATGCACTGCCCCATCACATCAGGAATACCGCCTGCCAGTCACCTGCAACCCCAGAGAACCT
GTCACCTTTGACCTTGACATCCGATTCCAACAGGTCAGTGATCCAGTGGCTGCTGAGTTTAGCTTGAACA
CCCAAATGTACCTGCTCTCTAAGAAGAGTCTCTGGTTGTCTGATGGATCCATGGGATTCGGGCAAGAGAG
TGATGTTGCTTTTGCAGAAGGTGATATAATTTATGGTCGTGTCATGGTGGATCCTGTCCAGAATCTGGGT
GACTCCTTTTACTGCAGCATTGAGAAGGTGTTTCTATGCACTGGAGCTGATGGCTATGTTCCCAAGTATA
GTCCAATGAATGCAGAATATGGCTGCTTAGCCGACTCTCCTTCACTCTTATATAGATTTAAAATTGTGGA
CAAAGCTCAGCCAGAGACACAAGCGACCAGTTTTGGAAATGTCCTATTTAATGCCAAACTAGCAGTGGAT
GACCCTGAAGCCATTCTCTTAGTGAATCAGCCTGGATCTGATGGATTTAAAGTCGACTCAACACCACTCT
TTCAGGTCGCTCTAGGCCGAGAATGGTATATACATACGATCTATACAGTGAGATCGAAAGACAATGCCAA
TCGAGGTATTGGCAAAAGAAGTGTGGAGTACCATTCTCTGGTGAGTCAAGGAAAGCCCCAATCCACCACC
AAGAGCCGGAAGAAGAGAGAGATCAGGAGCACACCCTCACTGGCATGGGAGATTGGTGCTGAAAACAGTC
GAGGAACAAACATCCAGCACATTGCCCTGGACCGCACCAAGAGGCAGATCCCCCATGGGAGAGCACCTCC
AGATGGCATCCTCCCCTGGGAGCTCAACAGCCCCAGCTCTGCAGTCAGCCTGGTCACTGTGGTGGGAGGC
ACCACGGTAGGGTTACTCACCATCTGCCTCACTGTCATTGCAGTGCTGATGTGCAGGGGCAAGGAAAGTT
TCAGGGGGAAGGATGCCCCGAAAGGCTCCAGCAGCAGTGAGCCCATGGTGCCCCCACAGAGCCATCACAA
TGACAGCTCAGAAGTTTGATGACTGCAGGTAGAATTCAACCTTTTCCGTAAGTGCCTCGGAAAAGATCAC
AATGGAACCTTAAATACTTCTGGTAAACCATAGAGAATGGAGGATGGCTGTGATGAAGCTGCTTAGAGAA
TATGACTGTACTAATGGAGTTTGATTTGAATTCTCCATACTCTTTTTTGCATCAAAGGACAAATTAAGGC
ATCTTTCCTCTTGCCCCAAAGGCAGCAACAACGTACTCATATGTACACAGAGCCATGATGTGAGGAATGT
ACTCCTCATTTTAGACATATTCTCTATGCAGTGGAGATAAATCTATTAAAAGGTGCTAACAGACTCTCTT
ACAAGTGTAAGAGGAATCTACTGTTGCTATGTTAGTGTGAATGTTGAAGGTGCAATTATCACATTGTTTA
TTAATTGTATAACAGATTATTACTAGAAAGGTTTTTGTTGCTAGTCTGGAAAACTGGTGAACACACTGTT
TATTATGACAAGTTTTCAAATAGGTGAAGACAGCATAGAATTATGACCAGGGTGGCTCAACCCACAAATC
AACTGATCTACTACTTGGGAGACAGTGGAAGGAAAGATAGAGGGAAGGAAGTTCACTCACTTGAATTTGA
ATTGCTTCTCATTCTCATCAGACTCTCCTTGTTTTGTTTGCATATTTAATTTTAAATTAAACCAAAGAAT
ATGTTAATTCTGAAAGAGATTTTTAAGAGATGCTGCTCTGTTTTGGCATATAGTGAGTAATGGTAGAGCT
CTTGCATGGTAATATACCTTATTGGTGCTCAACATTTGTGGGAAATTAGAGGGTTGGTGAGATTTTGGTG
ATGAATAAATGCCATAGAGTTAGAGTCACTACAAGACAATGTTCTCTAAGAACTGAGCCTAGATGTTTGC
AGTATTGAACCCATAAATGATAATAAGAAACATTGTTACAGATGGTGAAGGGAGAAAGTGGTATTTATTA
ATATAATGTGTATAATCAGAGTGCCTCTTATACATACTTTATAGAATAAAGGAACATTTTGACAGATGAG
GTTATCCCTCGGAGTAGCGTAATCACACAATAACATTTAGAACTTAAATTGGCTACAGGACATTTTATTA
GCTTTCTATCCAGCATCTGGTCCAAACGATGGGACTCTCTGCAACTATCATTCCAGAAATGGTCTTGGAG
GTGGCCAGAATCATTGACCATATTTTTATTTGGTTCAAGAAGACATCGCTCTGGCATCCCCAGTTCAGTG
AACTGGTACAATGTGGTCCCTCTCAATATTTAAAAATATAATTTGTAACAGTGCTTACCATTCACCTCCC
AAAGCCAAGGAACTTGAGTGAGCTTCCTTGGCAAGCCTCCCATTGCCTTTCTGCATCAATGTGTTTGTTA
CCAAATAGCAGAAATTTCGCTTAGAAGGGGAAAACTTCAGCTTTCCAAAAGCTAGTAAACATGTTTCAAA
GAAAAATAAGGTCAGGAGAAAAAGAATAATGCCTACAGATTATCCTTCAGATGCTGGCTAGAATCCCCTT
TGACTTCTAGCCATAAGCTGGCCACATTGGACATCTTGGTCACTGCAGAATTTTAAAAGGCAAACTTCTC
AGAACAGATGTGCACATCTTAATTTGGTGTCTGTAAGTATCAACCATTTCTTGATCAAGATAAGGAAGCA
ACACTGATACTGAGAGAGAGGTCATATGTCCAATAGTTGCCTTTCTTCTCTTAGGCAGCTCTGCACTTCA
TGTTCAGTTTTTTAAAAATAGACTGTAGTATCCTTTCATTGGAGAATTTACAAAAATATCATCTACAGCT
CAAAAGTCCCACTAACGGCTTATATGAACAGAAAGTACTGTGTAGCCCAGGAGTTTATTTAGCAAGATAA
ATAGTGGTAATTTCTTAATCATTCCCCTTTCCTTTGCTTTACCTTCTGGCAGATGCTTAGCTACTTCTTT
GGCTACCTCATAATTTGTATGGGAATGAACATGAATTAGGGAACTTCAAATAGTGCGTAGACTTTTCCCT
ACTTACCATTGGGTTCAATTGATGTAGACTGTTAGAGCAAGTATACTCAATCAACTTGCTGATATTTTAG
TAGTTAACAGCTTCCGAGCCTATCATGCAATTTGGAGTCTGTCAATGAATATAGCAATCGGTGAAGCATT
ACTGTACGAAGTCTGTTTTCAGGCTTTGGGTCAAGCTGGTTTTATACCAAATTTCACTCTACAATGCATA
TTCTAATGAAGCTACTTTATATAAATTGGAGAGCTTATAAAATGCAGAACATTTCTATCCTATCCTACCA
AATATTTATCCTTCTCTGTCCTCTATTCTCTTACTCTCCTCTCTCCCTTTTTCCTTCCCTTTATTCCCTT
GAAAAAAGAGAATCTGTGGGAAATAGGCAGATATAGCTTTTTAAAATATAAAGTACTTGGGATTTTGCAT
TATTTTTCTTAATATCTATTTACTAAGTATGTAATTTAATATACATTAATTATTTTTTGAAACTCTTGTT
AGTGGGAAGAATATGGTAAATTTTTTGTTAAATAAAATAGACCCTTATGTTTAGCATTTTGTTTTTAGAG
AACTATTCTGGTACTATCAGAACAAATACATAAAATAACTTCCCATAGAGAACAGGATATAGCAATAATA
GCTCCTTAGATACTCAGTGGCTTCTGACTCCAATCAAGGTCTTGTTGATATTATATAGTAAAAATAAAAC
CAAAAATAAATATTATTCAAGTGGCTCTTCTAAGCATGTGAATCATGAAGCACTGAAATATGTATTTTAA
TGATGATCTTATTTATTCCCATTTTTGCCCTTAGTTAACATTTACTGGTGCTCACCTAGGATTGGCTATT
CTGAGGGATTGCATAGAAACCAAGCTCCACTTGCTGTCCTTGGGAAGGTTATAACTGAATGCAGCTCTTT
ATTTGGACTAAAGTGTCAGGATATGCATTAGATTCTCTCCTGAACCAAAAACACAACAGTCATTATCTGT
GAACCATAATTTAAAAATCTTTCTAGAATAACAACAGCAGACTCCACTCTTGTTTGTCTAAAAGAGCCCT
ACTGGGTATGGATCATTCTGATGACAGATTTATACAAAATGATTCAAACCAGTAACTTAGTAAAATTGAC
CTTCGCAAAACCTCACTGGGGGAGTGCCTTGTAGAGCTGTGGGTGGGACTGCACATTCTTTTCCTCTTAG
TAAAAGATAGGCCCACTTTATTCCAAGAATAACACTTAGCACATAAACTCTTCTTCCAGCTCGTTAGCAG
CATTAGCACCTTCTGAATTCCACCCTCTCAGAAGAATCCACAGTGTTTGAACAATTTGCATAAAGGTCAG
CTAGCATCCTGCTGCCAAGCCACTGCATAGCATTTGTGATAAGAAGGACCAACTCTAGGCTCAATATGAA
GGGATTTAGTTCTGTAAGCAGCAAAAAAGCTTCTTTATCAAGTCATCTTACCTCTAATTCTTTTCCAGTG
TGCCAACTCCAAAGTCAACATTAAAAATGTAAATGGACCTGTGTAAATATCACAGAGAGCTTTTCCTTAT
ACATCTCAATGCTGAGAGTTAAAATATTCCCAGGTTAAAATTTTTTTAAAGTACCAATAATAGAGCTAAA
TACAATGACATTTGCTTTTAAAAGGTGGATATTTTATTTCTGCTTTTTGAAAATACTTATTTAGTATTGA
CTTGGAAGCCAATTTGGTCCTTTAATAAGTAAAGAAAATAATATGTTTAAAAATGTAAATGTTTTACAAA
TTTGAAACTTTCATAATTGTATTAATCAGAAAACAAGCACATTGCCATTCTTTGAAACTCATGTTTCTAG
ACATGACAGCAGTAATAAAAGGATGAAAACAAGTGTCTTCACTAAGCGTATGGCCAATAAATGGGACCCA
AACGTTCAATCTGTTCAGTTTACCAAGGTTCAGAAATACGTAATTTAGCAGGAAACTATAAATACCAGTG
CTATCACAGCCACACATACACACACACAGACATAAAATAACCAAACATCTCATTTCTAGGAAAGAGATAA
CACTAAAGGCATCATAGGTTTAACTGAAATACGTTATATGAAGTTTTACAAAAAGGTCAACAGAAAGCTC
ATTTGTGAAAACATACTCTCATGGGAGCTTCTTTAACATTAGTTCAGAGGTTAATATATTTCCTGGAGGT
GTTTTCCTAGAATTGATTGCACTATTGCATGGTAATAACATTTAATTGTTAAGGAAACATTATATATAGG
TTCAAATTATCCCTTAATGTTGATTTCTCCCCTTTTCCATGGATTTTGATACTAAGAAACAAAATGCTTT
GAGATTTTGGTAACTATTTTGATTTTGATAAAACATGTTAAAATAGAAGGACATGATATTTTTCTATAGT
TTCCATCAGGAAGAGTACATCAGAAACTTCTCCATAAGGAAAGAAAACTGACTCTCTCTTGAACTAGTGT
TGACAAAATACACTAATGTCTTTCTTAATTTTATTTTATTAGGAGAAAAATCAGAATATTAAATTTGCAA
ACTTTTGAACAGCAGTAATAGCTCCTTAGACACTCAGTATCTTTCTTCCCTATCTTTCAAGCACATTTAA
TTTCTTTCCCCTGGTATTTGTTTGCTTTGTGTTTTTTCAATATTTTGTTTGCTAAAGAACAATAACAACA
ACAAAGCTGGTCCAGCCCTGACACCTACTTTTGCTTTTTTTCTTTCTTTCTTTTAATTTGTTGAACTATA
GGTTTCTTTCTGAGATGTATTTTTCATTCTTCCAATAATGCTCTCTTTTTCATTTCAAAACCATTACCAC
TTTCAATATGTAATTAACATCCTCATTCATCAGAAAGCTGGTAAGTCCACACAGCATTTGTGCAGTATCC
CTTCTGTGTAAAATGTTAAGGCTTTCAGATGAAAGAAAAAAGAACTTCCTGCAAAAGATCAAAAGCATCA
TACTAAATAAAATGATGACAATATGTGCCTTGATTTTTCTCTCAATGGAGGTTCAACATTGACATTTAAG
ATGTAAAAAAAATTACTTTGATGGTTTAATTAAGAATAATAAGTCAAATATCACATGTATGTAGTTCTTT
TGGATGACCGAATACCTTAAAATGAACTAAATAACTGAAATAAAGTGTTAAAATGTTAACAGCGTTGAAG
TTTTTAAAATTATAATTATCAAATGCACAATGTTCTTTTACTATGCCAAATGTTGCCTACACTGATTACA
TGATTGTCACAGTTTAAGTGAATTTCTACTATGGATCTTTATTTTCCCCAATGTTTGGATCATCCTCTCA
GATAAGAATTGTCAGTATTGCACCTCAAGAAAGAAGAAAAAATAAGAATGTAAATTTTTAAAAGCTAGCA
TTAAAAGTAAAGAGCAGTACAATAAAAATCACTTAAAATAGAGAAAGGCAACTACTGAGTAAGAAGAAAA
GATAATTTCTGTAAAAGCTAAATTTATGCACATTACAAAAAGTAGTCAAGTCAGTCTTCCATTGTGACTT
CAGGAATTCAAATGCAAGTTGTTGGCAAAATATATATATACACACACACACACATACACACACATATATG
TACATACATATATATATAGAGAGAGAGAGATAGATTTTTTTTTTTTGAGACAGAGTTTCGCTCTTGTTGC
CCAGGCTGGAGTGCAATGGAATGATCTTGGCTCACCGCAACCTCCGCCTCCAGGGTTCAAGTGATTCTCC
TGCCTCAACCTCCTGAGTAGCTGGAATTACAGGTGCCCACTACCATGCCTGGCTAGTTTTTGTATTTTTA
GTAGAGACAGGGTTTCTCCATGTTGGTCAGGCTGATCTCGAACTCCCAACCTCAGATGATCCTCCCGCCT
CCACCTCCCAAAGTACTGGAATTACAATGGCGTGAGCCACCACAAGATATTTTTAAAGCCCATTTGTCTA
TAAAAGAAAACTCTTGGACAAGGAGCTTTGTGTTTTATAATTGTATTACGTGCCTGCTTCCTTACCAAGT
GCCCTCCATAACACTAAGTAAATTTATATTTATCTAGCCTCTGAGTGACATATCTGTGTGTAATGGAATT
ATTTGCAGAATTTAATAGCCTTTTTTATTTTCGCATGAGAATTTTTCAAAAACTATCAGGGTCTAGTTTT
ATCATACATTTACTAAGTTACTACATATTGGTGGATATTGACGTTTATTCCTGGGAATCTAATTTTGCAA
ACAATTTGGAGCCATTCAGTCATAAATTCATGTCAACAATAAGTCTTGCTGCCGCTTGTGTTTCATAACT
ACGCTTGCTTTCCTTCAAAATATACCAAGTGTGTAATATAAATAAAGCCCATATCAATATAAAAAAAAAA
AAAAAAAAA

Композиционный код 6:

5,3,5,5,3,5,5,3,4,4,1,1,3,2,3,5,5,2,5,3,3,5,5,3,5,5,3,5,5,2,3,2,5,3,5,5,3,5,3,3,4,4,4,1,1,1,2,5,5,5,
2,3,5,2,1,1,1,1,1,1,1,1,1,1,1,4,4,2,5,5,2,3,3,5,3,4,4,4,3,5,5,5,3,5,5,2,5,3,5,3,3,1,1,4,1,3,2,1,4,1,
1,4,1,6,1,2,5,5,3,5,5,3,1,4,1,4,2,1,1,1,1,1,3,3,2,2,5,2,4,4,1,4,4,4,4,4,4,4,3,5,5,2,5,2,1,1,1,4,2,5,
5,3,1,1,1,1,4,1,4,1,3,3,4,4,4,3,2,5,5,3,3,5,5,5,2,4,4,4,1,1,2,4,4,4,3,5,5,3,3,4,4,4,3,5,5,3,1,4,4,1,
1,4,1,1,4,1,1,1,4,3,5,2,2,5,5,5,2,5,5,5,2,4,1,1,4,3,1,1,1,1,4,1,1,3,5,3,1,1,4,1,1,3,1,4,1,4,1,1,4,3,
4,1,1,1,4,4,1,4,1,3,5,5,5,2,5,2,2,5,2,2,5,2,4,1,4,1,4,1,1,1,1,4,1,3,5,3,5,5,5,3,4,4,4,3,1,4,4,4,1,1,
3,1,4,1,4,4,1,4,1,1,1,1,1,1,1,2,1,1,1,1,4,1,1,4,1,1,1,1,4,4,3,5,3,2,3,1,1,1,1,4,1,1,3,2,2,5,3,5,2,1,
1,4,1,3,1,4,6,1,1,3,3,5,5,3,2,5,5,5,3,5,5,2,5,5,3,5,2,2,1,1,1,1,2,1,6,4,4,1,4,3,2,2,5,3,3,5,5,5,3,3,
5,3,1,1,1,1,1,3,4,4,1,1,2,2,4,1,1,1,3,2,5,5,5,3,1,4,1,6,6,6,6,1,4,1,1,3,2,4,4,1,4,1,2,4,4,4,2,5,5,3,
3,5,3,5,3,1,4,1,1,1,1,3,3,3,2,5,5,3,1,1,1,1,1,4,1,1,3,3,1,1,4,1,3,5,5,5,3,5,5,3,4,4,1,4,1,3,1,1,1,1,
3,3,3,5,3,1,1,1,1,1,3,3,5,3,5,5,2,5,3,2,3,2,2,3,2,5,3,3,5,5,5,2,4,4,1,1,6,1,2,5,3,4,4,1,1,4,3,5,3,3,
3,5,3,5,3,5,3,5,5,5,2,5,3,2,5,3,3,5,3,1,1,1,1,1,3,5,3,5,2,3,2,5,5,2,4,4,4,3,4,4,4,3,3,5,3,5,3,5,3,3,
5,3,5,5,3,3,5,5,5,3,2,5,3,5,5,2,1,1,1,4,1,1,1,3,3,5,3,1,1,4,4,1,1,1,4,4,3,4,4,4,3,2,2,1,1,1,1,2,5,3,
4,1,1,1,1,3,5,3,5,3,5,5,2,3,3,5,3,1,1,4,4,4,2,5,2,5,3,3,2,4,1,1,4,1,3,5,5,3,2,3,5,5,3,2,3,3,3,5,5,3,
3,5,5,5,2,5,5,3,3,5,5,3,5,3,5,5,3,3,5,3,5,3,5,5,5,3,3,5,3,5,3,1,1,1,1,4,2,3,3,5,2,2,5,2,1,1,1,1,1,1,
2,2,1,1,1,4,1,3,3,5,3,5,5,3,3,3,5,2,5,2,5,5,5,2,3,3,5,5,3,5,3,5,3,3,3,4,4,4,2,5,5,3,5,3,3,5,3,3,5,3,
5,5,3,4,1,4,1,3,5,3,5,3,3,5,5,2,5,3,5,5,5,2,2,4,1,1,1,1,4,1,1,3,5,5,5,2,3,5,2,3,2,3,5,2,5,3,5,5,5,2,
5,2,5,3,3,5,5,2,5,2,5,3,1,1,1,1,3,5,5,5,2,1,4,4,1,3,3,5,3,1,1,1,1,3,3,3,3,3,5,3,5,5,3,3,3,4,4,4,3,3,
2,4,1,1,1,1,1,1,4,3,5,2,3,5,3,5,3,2,3,5,3,5,3,5,5,3,1,4,1,1,1,2,3,1,1,1,1,1,1,1,3,3,5,5,5,3,1,1,1,4,
3,5,2,1,1,1,4,3,3,2,5,3,3,3,5,3,5,3,5,3,5,3,5,2,5,3,3,5,5,5,3,5,3,2,4,4,4,3,2,5,3,1,1,1,1,1,1,2,3,5,
5,2,3,5,3,5,3,3,4,1,1,1,4,3,3,1,1,1,1,3,5,3,5,3,3,3,4,4,1,1,3,5,3,2,3,5,5,2,5,3,3,3,5,5,2,5,5,3,3,3,
5,3,5,5,5,3,2,3,5,3,3,3,5,3,3,3,5,3,5,3,3,3,5,5,5,3,5,3,3,3,1,1,6,1,3,5,5,5,3,3,2,3,5,3,5,3,5,5,5,3,
5,3,2,2,5,5,3,3,3,1,1,1,1,1,1,3,3,2,3,5,5,5,3,3,5,2,5,2,5,3,3,5,3,3,3,5,5,3,5,2,3,5,3,3,3,5,3,3,3,5,
3,3,5,3,2,3,3,2,1,4,1,1,4,3,3,3,5,5,5,2,3,5,3,2,3,3,5,5,2,2,5,3,3,3,3,3,3,2,2,2,5,3,2,3,3,3,3,1,1,1,
4,3,3,1,1,1,1,3,2,3,3,5,3,3,2,3,3,3,3,5,3,3,2,2,2,5,3,5,3,2,3,2,5,3,5,2,3,3,5,5,5,3,3,1,1,1,1,1,2,5,
3,5,5,3,5,3,3,5,5,3,3,5,5,5,2,3,2,3,3,3,3,3,5,3,5,3,2,5,3,1,1,1,1,3,2,5,3,5,5,3,3,3,5,2,5,5,3,5,3,3,
3,5,5,5,3,5,5,3,5,2,3,3,2,5,3,5,3,3,3,3,3,3,3,5,5,3,3,3,3,5,3,3,5,3,5,5,3,3,3,5,5,5,3,5,5,2,3,5,5,3,
5,5,3,1,1,1,1,3,5,5,2,5,3,5,5,3,3,3,5,3,3,1,1,1,1,1,3,5,3,3,5,3,3,2,2,3,5,5,5,3,5,3,1,4,1,1,3,2,3,5,
3,3,3,3,5,5,5,3,5,3,5,3,3,2,2,3,2,3,3,5,3,5,5,3,5,5,5,3,2,3,5,2,2,3,3,3,2,3,5,3,3,5,3,3,3,3,3,3,5,2,
2,3,5,3,3,5,3,2,3,3,3,3,5,3,3,3,5,2,5,5,5,3,3,5,5,3,3,2,5,3,5,3,3,5,3,5,3,5,5,3,5,5,3,5,5,2,3,3,3,3,
5,3,3,2,2,3,5,5,2,3,3,5,3,3,4,1,1,4,1,3,5,3,5,5,3,3,5,2,3,5,2,5,5,5,3,3,3,5,3,5,3,3,2,2,5,2,2,5,3,3,
5,5,5,3,3,3,3,5,5,3,3,1,1,1,1,3,5,5,2,3,5,5,3,5,5,3,5,3,3,4,1,1,4,3,5,3,5,5,3,5,3,2,5,3,1,1,1,1,1,2,
3,3,3,3,5,3,5,5,3,3,5,3,3,5,5,3,2,3,5,3,5,3,5,2,5,3,5,5,3,5,3,5,5,3,3,5,2,4,1,1,1,1,1,4,3,5,3,3,3,3,
4,4,4,3,3,3,3,5,5,3,5,3,5,3,3,3,3,1,1,1,4,3,5,3,1,1,1,4,3,3,3,5,3,5,2,5,5,3,5,3,3,5,5,3,3,5,5,3,5,5,
3,3,5,3,5,5,5,3,3,3,5,3,5,2,3,3,3,1,1,1,1,2,5,3,3,5,5,3,2,5,5,3,3,3,3,3,5,5,3,3,2,5,3,5,3,4,6,1,1,1,
1,1,3,3,5,5,3,5,5,3,5,2,5,3,5,5,5,3,2,3,5,3,2,5,3,1,1,1,4,1,6,1,2,5,3,2,5,3,5,5,5,3,5,5,3,5,3,3,3,3,
3,5,5,2,5,5,3,3,3,2,3,3,1,1,4,1,3,1,1,1,1,1,3,5,5,2,3,3,5,3,3,5,5,3,2,5,3,5,3,3,3,5,3,3,5,2,3,3,5,5,
3,3,2,3,3,3,3,3,2,5,5,3,5,5,5,3,3,3,5,3,5,2,5,5,5,3,3,5,3,3,5,5,5,3,5,5,5,3,3,2,3,3,3,3,3,3,3,3,5,5,
2,3,3,3,3,2,3,3,5,2,3,5,3,3,2,3,3,5,3,1,1,1,1,3,2,5,3,3,4,1,1,1,2,1,1,1,1,1,2,5,2,4,4,1,4,3,3,5,5,3,
5,5,3,3,5,3,5,5,2,5,2,1,1,4,4,3,5,5,3,5,5,2,5,5,3,3,5,5,3,3,2,2,3,5,2,3,5,3,3,5,5,5,3,5,5,3,3,3,3,3,
3,5,5,5,3,1,1,1,1,1,2,3,4,1,1,1,1,6,4,1,3,3,5,3,3,2,2,2,3,2,3,5,5,3,5,5,5,3,5,3,3,5,2,5,5,3,1,1,1,1,
3,3,5,5,3,5,3,3,3,5,5,3,5,3,5,2,5,2,3,3,5,3,1,1,1,1,1,3,5,5,3,5,3,4,1,6,1,6,4,2,3,5,2,2,5,5,2,5,3,3,
3,2,5,3,3,5,3,3,3,3,5,5,3,5,5,3,3,5,3,5,3,5,3,5,3,3,5,3,5,3,4,1,4,1,3,5,5,3,1,4,1,1,3,3,3,5,2,5,5,3,
5,3,2,3,3,5,3,2,3,3,2,2,5,3,4,1,1,1,3,3,3,3,3,2,3,2,1,1,6,1,3,3,3,3,5,3,5,3,5,3,2,3,2,5,5,5,2,3,5,3,
3,3,5,5,3,5,5,3,5,5,2,5,3,1,1,1,1,3,5,2,5,5,2,3,5,3,5,5,3,5,3,5,5,3,5,3,3,2,2,3,3,5,5,3,3,3,5,5,2,3,
2,5,5,3,5,3,5,3,5,5,5,3,3,2,5,3,1,1,1,4,1,4,3,2,1,4,6,6,1,3,3,3,5,2,5,3,3,1,1,1,1,2,5,5,3,3,5,2,3,5,
5,5,3,3,1,4,6,1,3,5,5,3,5,5,2,1,1,1,1,4,2,5,5,3,2,3,5,5,3,5,3,5,3,2,3,3,3,3,3,3,3,5,2,5,5,2,3,3,3,3,
5,3,3,3,3,3,2,3,5,3,3,3,5,3,3,5,3,3,3,2,4,4,4,3,2,3,3,2,5,3,5,3,2,5,3,2,5,3,5,3,5,3,1,1,1,1,3,1,4,1,
1,3,2,3,5,5,5,3,5,2,3,3,3,5,3,5,3,5,3,1,1,1,4,3,3,5,3,3,5,3,4,4,4,3,5,5,3,5,5,5,3,3,5,2,3,3,3,3,3,5,
2,2,1,6,1,1,4,3,5,3,5,5,2,3,3,6,1,1,6,2,3,5,3,3,3,3,5,3,3,3,2,1,4,1,6,3,5,5,3,5,3,3,5,5,3,3,3,5,5,3,
5,3,3,5,5,3,5,2,3,5,5,5,3,3,2,5,5,3,3,2,5,3,5,3,2,3,5,5,5,3,5,3,1,4,4,1,4,1,4,3,3,2,3,5,5,3,5,3,5,5,
5,3,5,3,3,4,1,1,1,1,3,3,5,2,1,1,6,1,2,5,5,5,2,5,3,5,3,4,4,4,2,5,5,2,3,3,3,5,5,5,3,5,3,3,1,4,1,1,6,1,
3,3,2,5,5,5,3,3,3,3,3,3,5,5,3,2,3,5,3,3,2,2,5,5,5,2,3,3,5,5,5,2,5,3,5,3,2,5,5,2,5,3,5,5,5,3,5,2,5,2,
5,2,3,1,6,1,1,4,1,1,3,3,5,3,5,5,3,1,1,1,1,1,3,3,5,2,3,3,2,1,1,1,1,1,1,1,4,3,3,3,3,5,5,3,3,3,3,5,5,3,
3,3,5,3,3,2,3,2,3,2,5,2,3,3,1,1,1,1,1,1,1,3,3,5,3,1,1,1,1,1,4,1,4,1,2,5,5,3,3,5,5,5,3,5,5,3,5,5,2,3,
5,3,3,5,3,3,5,5,3,2,2,3,2,5,5,2,5,2,5,5,5,3,5,5,3,2,5,3,5,3,3,1,1,4,1,3,1,1,4,4,2,2,5,5,5,3,3,5,5,5,
2,5,3,3,2,3,3,4,1,1,1,1,1,1,1,3,3,2,3,5,5,5,2,5,3,3,3,3,3,3,5,3,2,1,1,6,1,1,3,3,1,4,1,1,1,4,1,1,1,2,
5,3,5,5,3,5,3,3,5,5,2,3,5,2,5,3,2,5,2,5,5,5,2,3,3,3,2,5,5,2,3,1,1,1,1,2,5,3,3,2,5,3,5,5,2,2,1,1,1,1,
3,5,3,5,3,5,2,3,5,5,2,5,5,3,3,4,1,4,4,2,5,3,5,2,2,3,5,3,4,4,4,2,1,1,1,1,1,3,3,3,5,5,3,5,3,5,5,2,5,3,
5,5,3,3,2,5,3,3,5,3,1,1,1,1,3,6,1,4,1,3,5,5,3,5,5,5,3,3,2,5,5,2,5,5,3,5,3,3,3,3,3,2,3,3,3,2,3,3,3,3,
4,4,4,3,3,5,5,3,5,3,5,5,3,5,5,5,3,4,4,4,3,2,5,3,2,3,3,5,3,3,5,5,3,3,2,5,3,2,3,3,5,5,3,5,5,3,3,2,5,3,
3,3,3,3,3,5,5,3,3,5,2,5,2,3,5,5,3,3,2,3,5,2,3,3,5,3,2,2,5,3,5,3,3,5,3,5,3,5,3,5,3,2,3,3,2,3,3,5,5,2,
2,2,5,3,5,5,3,2,5,2,3,5,3,2,3,5,5,3,2,5,3,5,3,5,3,5,3,2,3,3,5,3,3,3,5,5,5,3,3,5,5,3,3,2,5,5,3,1,1,1,
1,1,4,1,1,3,1,1,1,1,2,5,2,5,2,5,5,3,3,3,3,5,3,2,2,2,1,1,1,1,3,1,4,1,1,1,1,1,1,1,1,3,5,3,2,3,2,3,1,1,
1,1,1,1,1,1,1,1,1,3,2,1,1,4,1,3,5,5,2,4,4,4,2,5,3,1,1,1,1,1,3,5,3,2,4,4,6,1,1,1,1,3,3,1,1,4,1,3,5,5,
3,1,1,1,1,3,1,1,6,4,1,2,5,5,3,5,3,5,5,2,3,3,1,1,4,1,2,3,5,5,3,5,3,5,5,5,2,3,3,5,3,2,5,3,3,3,3,3,3,2,
5,3,5,5,3,5,3,3,3,3,3,5,3,2,1,4,1,1,1,3,5,3,5,3,5,3,3,3,3,5,5,3,2,3,3,5,2,3,1,1,1,1,3,5,5,3,3,3,3,3,
5,5,2,5,2,5,3,5,3,3,3,3,3,3,3,3,3,5,3,2,5,5,2,3,2,3,3,3,3,5,3,5,3,5,5,3,5,5,3,2,5,5,2,3,5,3,3,3,5,5,
5,3,3,5,3,3,3,5,5,3,5,3,3,3,2,3,5,3,5,5,2,5,5,3,3,3,3,5,3,3,3,3,5,5,3,2,3,5,5,3,5,3,3,3,6,1,1,4,3,3,
5,2,3,3,4,1,1,1,1,2,5,3,2,5,3,3,3,5,5,3,3,5,2,3,3,3,3,5,3,5,3,5,5,3,5,5,5,3,3,5,3,3,5,3,5,3,3,2,5,3,
5,3,3,5,3,5,3,3,5,3,5,5,3,3,5,2,3,3,1,1,1,1,1,3,5,5,2,2,5,3,3,3,3,3,3,5,5,3,3,3,4,4,4,3,3,5,5,5,2,3,
5,2,5,3,5,2,2,3,5,3,3,5,5,3,5,5,2,3,3,5,3,3,3,5,2,3,3,3,5,3,3,3,5,3,1,1,1,1,3,5,2,3,3,3,2,5,3,2,5,3,
5,3,3,2,3,3,3,5,3,3,2,2,3,1,1,6,1,3,5,5,2,2,5,5,2,5,3,5,3,5,5,3,3,5,2,5,5,3,3,3,3,5,3,2,2,3,3,2,5,3,
5,3,5,5,5,3,3,5,3,3,3,3,2,3,5,5,3,3,5,2,3,3,3,5,3,3,3,5,5,3,5,2,5,2,3,5,5,3,3,2,6,1,1,1,2,2,3,3,3,2,
3,3,5,3,3,5,3,2,3,5,3,5,5,3,3,5,5,3,5,5,2,5,5,2,5,3,5,5,5,3,5,3,3,5,3,5,5,3,3,5,3,3,5,3,5,5,5,3,2,3,
3,3,3,3,3,2,5,3,3,5,5,5,3,3,3,2,5,3,2,3,3,3,2,3,3,5,5,3,5,3,5,3,2,5,2,5,5,2,3,5,2,3,5,2,5,5,3,3,3,5,
3,3,3,5,5,3,3,2,3,3,3,5,5,3,2,3,5,5,3,1,1,1,1,2,5,5,3,1,1,1,1,1,3,3,3,5,5,3,3,5,3,3,3,3,1,1,1,1,3,2,
3,2,3,3,5,3,5,3,2,2,5,3,3,5,3,3,5,3,3,1,1,1,1,2,3,5,2,2,5,3,3,5,5,3,5,5,3,2,5,5,5,3,3,5,3,3,3,5,5,5,
3,3,3,3,5,3,5,3,5,3,1,1,1,1,6,3,5,5,5,3,5,5,5,2,3,3,5,2,5,5,5,3,5,2,3,2,3,3,5,5,3,3,5,5,3,2,5,3,2,3,
3,2,5,3,5,5,5,3,3,3,2,3,5,5,3,3,3,3,5,5,3,5,5,2,2,5,3,5,5,3,5,3,3,3,5,3,5,5,5,3,3,2,2,3,5,3,2,5,3,5,
2,5,5,3,3,5,3,3,5,3,2,5,3,3,2,5,5,2,3,3,2,3,5,3,3,3,3,5,5,5,3,3,5,2,5,5,3,2,3,5,3,5,3,3,2,5,3,5,3,3,
5,5,3,3,3,5,3,3,5,3,3,3,3,3,3,5,2,3,5,5,2,5,3,3,3,2,5,3,3,5,3,3,2,3,3,5,3,2,3,3,5,5,2,3,3,3,2,5,3,3,
3,3,5,3,5,5,3,5,2,3,2,5,5,3,3,3,5,2,3,5,5,3,5,3,5,3,5,3,3,5,5,3,3,3,3,5,3,2,3,2,5,3,5,5,2,5,3,2,2,3,
5,3,3,5,5,3,3,3,5,5,3,5,3,2,1,1,1,1,1,2,3,3,3,3,3,3,5,3,3,3,3,3,2,3,5,3,3,5,3,5,3,3,3,2,5,3,3,2,3,5,
5,5,3,3,3,5,2,3,5,5,3,3,5,3,5,5,5,2,3,5,3,5,3,3,5,2,5,3,3,5,3,3,2,3,3,5,3,5,5,3,2,3,3,5,5,3,3,3,2,2,
5,3,5,3,5,3,5,3,1,1,1,1,3,5,2,2,5,3,5,3,3,2,5,3,3,3,3,3,3,2,2,2,2,5,5,3,3,3,3,2,3,1,1,1,1,2,5,5,3,5,
5,2,3,3,5,3,5,3,3,5,3,5,3,2,3,5,5,5,2,3,3,4,4,4,3,1,1,1,1,3,4,1,1,1,2,5,3,5,3,5,5,5,2,5,2,3,3,5,5,3,
5,3,5,5,2,5,3,3,4,4,4,3,2,2,3,2,3,3,3,5,5,3,5,3,3,5,5,3,3,5,2,3,5,2,1,1,1,1,3,3,3,5,5,2,5,3,5,3,3,3,
5,5,5,3,5,5,3,3,3,3,5,3,5,5,3,5,5,3,3,5,5,3,5,5,2,3,1,1,1,1,3,5,3,5,2,3,2,5,2,2,3,3,6,1,6,1,4,3,3,3,
5,3,5,3,5,3,2,3,5,3,3,5,3,5,3,3,5,5,3,3,3,3,5,3,5,3,3,3,3,3,5,3,5,3,5,3,4,4,4,3,3,3,3,5,3,3,3,3,3,3,
3,2,5,3,5,5,2,3,5,5,3,3,5,5,3,3,5,3,3,5,3,3,3,3,3,2,3,5,3,3,2,5,5,3,5,2,3,5,5,5,3,5,3,3,5,5,2,3,5,5,
2,1,1,1,1,1,1,3,3,5,5,3,3,4,4,4,3,5,3,5,5,2,5,3,3,2,5,3,2,3,5,3,3,2,3,2,3,3,3,2,2,5,3,3,5,5,5,3,5,5,
5,2,5,2,5,2,5,2,3,5,2,5,5,2,3,2,2,5,3,1,1,1,1,3,3,5,3,5,5,3,5,3,3,3,3,3,3,3,3,3,5,3,3,3,5,5,3,3,3,5,
5,2,3,3,3,2,3,3,5,5,3,2,3,1,4,1,4,3,5,5,3,5,5,5,3,5,5,2,2,2,3,3,3,5,2,5,3,2,3,5,5,3,3,5,3,3,3,3,5,5,
3,3,2,5,3,5,2,2,3,5,3,5,3,5,3,3,3,5,3,3,3,3,3,3,2,3,5,3,3,5,2,5,3,3,3,2,3,1,1,1,1,3,2,2,3,3,3,2,5,2,
5,3,3,5,3,1,1,1,1,3,5,3,3,2,2,5,3,5,3,3,3,3,3,5,5,3,3,5,3,3,3,3,2,5,3,5,2,2,2,2,3,3,5,2,5,3,5,3,3,5,
3,3,2,5,2,3,3,5,3,5,5,2,3,3,5,3,5,3,3,3,3,3,3,5,5,3,2,2,2,2,2,1,4,1,1,1,1,1,2,3,5,3,3,5,3,3,3,3,3,5,
5,5,3,5,3,3,3,5,5,3,3,2,5,5,3,5,5,3,3,3,3,5,3,5,3,5,3,5,3,5,5,3,2,5,2,5,5,3,5,5,2,3,2,5,5,3,3,2,2,5,
3,5,3,3,5,3,5,3,2,3,3,3,3,1,1,1,4,3,5,5,3,5,5,2,2,3,3,5,5,2,2,3,5,5,3,3,5,2,5,5,3,3,3,5,3,3,3,3,3,3,
3,5,3,3,3,3,3,5,3,3,5,2,3,5,2,3,5,5,5,3,5,5,5,3,5,3,3,5,5,5,2,3,3,2,5,3,5,3,3,5,5,3,3,3,3,3,3,2,3,5,
3,5,2,5,5,3,5,3,5,3,3,5,2,5,5,3,3,3,3,5,3,3,3,3,3,2,2,5,5,3,3,5,5,3,3,1,1,1,1,2,3,5,3,3,5,3,5,5,2,3,
5,5,3,3,5,3,3,3,3,3,3,3,5,3,3,3,3,5,5,5,3,3,3,5,3,3,5,3,5,2,3,3,5,5,3,3,5,2,3,3,2,3,3,3,3,5,5,3,2,3,
3,3,3,5,3,3,2,5,5,3,5,3,5,3,1,1,1,1,2,3,3,2,3,2,5,2,5,2,5,2,5,2,3,2,3,2,3,2,3,3,5,3,5,2,3,3,3,3,5,3,
5,3,5,3,3,3,5,5,3,2,5,3,5,3,3,3,5,2,5,3,3,5,3,2,4,1,1,1,1,1,1,1,1,1,4,3,5,5,3,5,5,5,2,2,2,5,5,3,3,3,
3,3,3,3,3,5,5,3,3,2,3,5,2,5,5,3,2,3,5,5,5,3,1,1,1,1,1,1,1,2,5,5,5,3,5,3,1,4,1,1,1,1,2,3,3,5,5,3,3,2,
5,5,3,3,3,2,3,2,3,5,3,3,2,3,2,3,3,5,5,5,3,5,5,5,3,2,5,5,5,2,3,3,3,3,3,1,1,1,4,2,3,5,3,2,5,3,3,3,2,3,
3,3,5,3,3,3,3,5,5,3,3,3,3,3,2,2,5,3,3,3,5,2,3,3,2,3,5,5,2,5,5,3,3,5,3,3,5,5,3,3,3,3,2,5,3,5,5,2,5,3,
3,3,5,5,2,2,2,3,3,3,5,3,3,3,2,5,2,5,5,3,5,5,3,2,5,3,5,3,3,2,3,3,5,3,5,3,2,3,3,3,3,3,

Вторичная структура (Пикотех-2017) весит около 6 мегабайт в стандарте PNG. На яндекс-фотки не грузится. Но самый интересный фрагмент удалось вырезать в программе Paint:

Изображение

Сиреневым цветом отмечен виток необычной метиониновой спирали. В отличие от альф-спирали у неё более длинный шаг. Метиониновая спираль отличается от обычной альфа-спирали примерно как резьба с более крупным шагом от резьбы с менее крупным шагом:

Изображение

Шаг метиониновой спирали примерно на 25% крупнее шага обычной альфа-спирали. При этом на один виток приходится тоже 3.6...3.7 аминокислотных остатка Met.
Kushelev M
Автор темы
Аватара
Откуда: г.Дмитров
Репутация: -204
Сообщения: 3307
Темы: 233
С нами: 3 года 5 месяцев

Вернуться в Уголок Кушелева

Кто сейчас на форуме (по активности за 5 минут)

Сейчас этот раздел просматривают: 1 гость

cron