Вот такие вот сказочки 2!

Список разделов Прочее Флудилка

#1 Шквал » 20.11.2016, 15:27

Судя по фамилиям, девочки были не местные. Мне с ними встретиться дома на едине так и не удалось - общался только по телефону.., Приехали девочки, посмотрели на меня, подмигнули и стали ждать., Потом мы все втроём взялись за руки и с весёлым смехом побежали в кафе кушать мороженое.

Противоречия, противоречия. Сказка ложь, да........)))
Чудес не бывает, бывает всякая фигня, похожая на чудеса.)
Шквал M
Автор темы
Аватара
W W
Возраст: 42
Откуда: Нижний Новгород
Репутация: 17 (+22/−5)
Лояльность: -2
Сообщения: 86
Темы: 2
Зарегистрирован: 14.01.2016
С нами: 1 год

#2 Шквал » 20.11.2016, 19:00

Одни сплошные противоречия. Общался только по телефону, не срастается с тем, что они тебе подмигнули и мороженное вместе ели. Когда ты пишешь, что судишь по фамилиям, местные или нет, а потом оказывается что ты их видел лично, это опять противоречия. Детали, они часто вредят врунам.)))
Чудес не бывает, бывает всякая фигня, похожая на чудеса.)
Шквал M
Автор темы
Аватара
W W
Возраст: 42
Откуда: Нижний Новгород
Репутация: 17 (+22/−5)
Лояльность: -2
Сообщения: 86
Темы: 2
Зарегистрирован: 14.01.2016
С нами: 1 год

#3 МАУС » 21.11.2016, 02:12

А воду родниковую там инопланетяне выпаривать будут? :mocking:
МАУС
Аватара
Откуда: СССР
Репутация: 46 (+46/−0)
Лояльность: 55
Сообщения: 344
Темы: 9
Зарегистрирован: 30.05.2016
С нами: 7 месяцев 23 дня

#4 искатель » 21.11.2016, 19:33

Може хватит воду вываривать, ато вон у египтян всю выпарили ,теперь пустыня у них .

Но всех лучше выпариватели мозг выпаривают . Я начинаю думать что именно с этой целью их и построили .
искатель M
Аватара
Возраст: 42
Откуда: с земли
Репутация: 200 (+209/−9)
Лояльность: 23
Сообщения: 1377
Темы: 6
Зарегистрирован: 22.05.2015
С нами: 1 год 8 месяцев

#5 Орбит 2 » 02.01.2017, 13:15

Жду продолжения . По больше юмора !
Орбит 2
Репутация: 2 (+4/−2)
Лояльность: 0
Сообщения: 42
Темы: 1
Зарегистрирован: 31.12.2016
С нами: 21 день 11 часов

#6 Орбит 2 » 02.01.2017, 14:07

В шестой сказочке так и было? И куда он выкладывал , мне интересно стало. Есть хоть какая то инфа?
Орбит 2
Репутация: 2 (+4/−2)
Лояльность: 0
Сообщения: 42
Темы: 1
Зарегистрирован: 31.12.2016
С нами: 21 день 11 часов

#7 МАУС » 02.01.2017, 15:38

Таки получается наш Упырь ещё и извращенец что ли?
МАУС
Аватара
Откуда: СССР
Репутация: 46 (+46/−0)
Лояльность: 55
Сообщения: 344
Темы: 9
Зарегистрирован: 30.05.2016
С нами: 7 месяцев 23 дня

#8 Орбит 2 » 02.01.2017, 20:06

Спасибо Игорь за информацию !
Орбит 2
Репутация: 2 (+4/−2)
Лояльность: 0
Сообщения: 42
Темы: 1
Зарегистрирован: 31.12.2016
С нами: 21 день 11 часов

#9 Kushelev » 16.01.2017, 01:24

Пикотехнология белков, ДНК, РНК - 2

Кушелев: Создаём новую версию Пикотехнологии 2D...

Skype, 2017-01-15:

[0:11:06] Кушелев Александр Юрьевич: На первом этапе хотелось бы получить следующую версию композиционного кода. Новые варианты композиции показаны красным цветом в правом столбце:

Изображение
[11:45:58] Кушелев Александр Юрьевич: Конечно, я могу и вручную написать композиционный код 6, но программа сильно сэкономила бы время...
[12:46:46] Va12220(valqwa): не напишешь
[12:46:54] Va12220(valqwa): я вернулся. ты скучал ?
[13:01:39] Кушелев Александр Юрьевич: Ты можешь подправить программу от Prosolver?
[13:10:45] Va12220(valqwa): Это старая версия 2D: http://nanoworld.narod.ru/Pikotech2D_3.6.zip ?
[13:13:06] Кушелев Александр Юрьевич: Возьми новую. Она копирует в буфер обмена данными композиционный код.
[13:13:30] Кушелев Александр Юрьевич: Сможешь сделать, чтобы код был таким, как справа?

Изображение
[13:14:05] Va12220(valqwa): справа - это где красные цифры 5 и 6 ?
[13:14:10] Кушелев Александр Юрьевич: Да
[13:15:08] Кушелев Александр Юрьевич: Цифра 6 связана только с одним кодом Met, т.е. ATG
[13:15:26] Кушелев Александр Юрьевич: А цифра 5 - одиночные коды "1" или "4"
[13:16:26] Кушелев Александр Юрьевич: Если в составе спиралей, то они "1" и "4", а если до витка спирали не дотягивает, то "5"
[13:19:06] Кушелев Александр Юрьевич: На примере лизоцима я обнаружил, что структура белка может быть напряжённой, т.е. по коду 4 атомные группы как бы вдавливаются в соседние. А если был бы код 1, то не вдавливались бы. Но в этом белке нужно получить напряжённое состояние, поэтому код 1 в процессе эволюции заменился на 4.
[13:19:42] Кушелев Александр Юрьевич: Так что без учёта физики некоторые белки мы не сможем правильно построить.
[13:20:01] Кушелев Александр Юрьевич: Только ненапряжённые.
[13:24:57] Va12220(valqwa): пробую разобраться
[13:26:16] Кушелев Александр Юрьевич: Чем быстрее сможем настроить программу, тем быстрее сможем заинтересовать заказчиков. Не настроенная программа отпугивает. Американский заказчик отвалился.
[13:27:14] Кушелев Александр Юрьевич: Там ещё менеджер схалтурил. Я ему говорил, чтобы он предупредил, что программа ещё не отлажена, есть ошибки. А он не передал американцам. И вторичную структуру вообще не показал...
[13:41:55] Va12220(valqwa): ну... ничего про него не скажу.
[13:41:58] Va12220(valqwa): жди немного
[13:55:11] Кушелев Александр Юрьевич: Кстати, если Met не в составе альфа- или 310-спирали, то его код 5.
[14:04:35] Va12220(valqwa): погоди. я запутался. пару шагов обратно:

(я с тобой) мы делали ранее 2 задачи
1 - преобразование .fast (.dne) в композиционный вид (код)
2 - а далее этот комппозитный код "крутили-вертели" и получали .PDB результат. (неплохой кстати), но только остановились на ... структуре.
а ты сейчас предлагаешь старую программу на паскале "исправить"
[15:17:39] Va12220(valqwa): мы работали с такой таблицей
[15:19:33] Va12220(valqwa): согласно этой табилце мы преобразовывали элементы FAST ('aca') в композитный код ('2')
[15:22:23] Va12220(valqwa): получив композитный код (мы это делали на примере кода коллагена), мы строили цепочку (точек, вершин) методом сдвигов и поворотов.
полученную цепочку записывали в файл PDB формата. и далее "смотрели " полученную молекулу в PDB-вьювере.
[17:18:35] Кушелев Александр Юрьевич: Да
[17:21:43] Кушелев Александр Юрьевич: В 3D алгоритме было заложено "альфа-спираль", если коду "1" предшествуют 3 кода "1" или "4" и "310-спираль", если коду "4" предшествуют 2 кода "1" или "4". В противном случае это не код "1" или "4", а код "5"
[17:22:18] Кушелев Александр Юрьевич: В программе от Prosolver это нужно реализовать.
[17:22:45] Кушелев Александр Юрьевич: Т.е. чтобы номера кодов выводились в схему и в буфер обмена данными.
[18:21:30] Va12220(valqwa): понятно. не прочел то что я пишу. все о своем пишешь. того что ты пишешь - недостаточно. пропускаешь полезные моменты.

и так. все преобразования что ты делаешь - они закодированы в первичном варианте таблицей (ту что я тебе скинул).
Таблица сопоставляет тройки (буквенного)кода определенным вариантам преоброзований. До нынешнего момента - это были варианты: 1 2 3 и 4

верно ?
[18:25:02] Кушелев Александр Юрьевич: Да
[18:25:29] Кушелев Александр Юрьевич: Но нам мало таблицы
[18:25:41] Va12220(valqwa): стоп.
[18:26:40] Кушелев Александр Юрьевич: Нам нужно добавить алгоритм. "Если коду "1" предшествуют коды "1" или "4" (не менее 3), то это - код "1". Если менее, то это - код "5"
[18:27:16] Va12220(valqwa): и так - берем фаст код. и получаем (используя таблицу) - кодовую таблицу (вероятных) будущих преобразований.

НО - этого недостаточно.

прежде чем делать будущие преобразования - необходимо полученный кодовый набор обработать.

верно ? что бы учесть варианты спиралей и прочие тонкости структуры
[18:27:31] Кушелев Александр Юрьевич: Да
[18:29:31] Va12220(valqwa): ну слава богу.

значит сл. этап - взять кодовый (цифровой) набор и с ним пработать. сл. образом:
по очереди давай смотреть:

если встретилась цепочка "1 1 1 1" - то она должна быть преобразована в цепочку "1 1 1 6"
[18:29:34] Va12220(valqwa): верно ?
[18:30:45] Va12220(valqwa): у тебя так по картинке выходит
[18:30:48] Кушелев Александр Юрьевич: Нет. Должна остаться 1111, если там нет Met
[18:31:41] Кушелев Александр Юрьевич: Met в окружении "1" или "4" должен из "1" превратиться в "6"
[18:31:59] Va12220(valqwa): т.е. условие более сложное. надо анализировать так же и буквенную последовательность
[18:32:11] Кушелев Александр Юрьевич: Да. Это только для Met
[18:34:03] Кушелев Александр Юрьевич: А коды:
212 -> 252
313 -> 353
2113 -> 1553
[18:34:41] Кушелев Александр Юрьевич: 21142 -> 24442
[18:35:11] Va12220(valqwa): 213 - 253 ?
[18:35:19] Кушелев Александр Юрьевич: Да
[18:35:28] Кушелев Александр Юрьевич: 243 - 253
[18:35:33] Va12220(valqwa): и много таких комбинаций ?
[18:36:07] Кушелев Александр Юрьевич: Прилично
[18:36:12] Кушелев Александр Юрьевич: Под сотню
[18:36:22] Кушелев Александр Юрьевич: Теоретически можно и таблицей задать
[18:37:25] Кушелев Александр Юрьевич: Но можно и логически
[18:38:39] Кушелев Александр Юрьевич: Если встречается менее 3 подряд символов 1 или 4, то они заменяются на 5
[18:39:46] Va12220(valqwa): так или так но надо описать. включая примеры. что бы я мог логику встроить в программу и проверить потом.
[18:40:25] Va12220(valqwa): а преобразования кодам 5 и 6 ты знаешь какие надо применить ?
[18:40:26] Кушелев Александр Юрьевич: Если встречается менее 4 символов подряд 1 или 4 (последний "1"), то они заменяются на 4
[18:40:44] Кушелев Александр Юрьевич: Да. Углы другие
[18:42:17] Кушелев Александр Юрьевич: Сначала нужно заменить 1 на 4, если 1 или 4 подряд меньше 4. А потом заменить 4 на 5, если подряд меньше 3
[18:42:36] Va12220(valqwa): вот смотри - ты пишешь:
[18:40] Кушелев Александр Юрьевич:

<<< Если встречается менее 4 символов подряд 1 или 4 (последний "1"), то они заменяются на 4
это обозначаем - 1 2 или 3 символа, последний 1 - я так понимаю - это все же 2 или 3 символа

пиши примеры
[18:44:16] Va12220(valqwa): и ещё вопрос.
в наборе 1-3-4-4-2-1-3 попалась цепочка из 3х символов - например 1-3-4 я её меняю на 1-3-5
далее я начинаю рассматривать сл варианты из этой последовательности 3-4-4 - её я должен поменять на 3-4-5

НО при этом я уже ранее поменял среднюю 4 на 5
[18:46:12] Кушелев Александр Юрьевич: 111->555
411->555
141->555
441->555
114->444
144->444
414->444
444->444
[18:46:43] Кушелев Александр Юрьевич: 1114->1444
[18:47:21] Кушелев Александр Юрьевич: 1141->4441
[18:47:37] Кушелев Александр Юрьевич: Похоже, что придётся таблицу составлять. Там не всё так просто
[18:48:01] Va12220(valqwa): ну вот слава богу - дошло до тебя. )
[18:49:36] Va12220(valqwa): пока ты будешь выводить правило замены - я закончу то что не доделал почти год тому. программу "савина-неделько"
[18:49:39] Кушелев Александр Юрьевич: Тут придётся повторять логику рибосомы.
[18:50:10] Кушелев Александр Юрьевич: Рибосома ставит аминокислоты по очереди.
[18:50:32] Va12220(valqwa): мне это не знакомо так как тебе. извини. не помогу
[18:50:33] Кушелев Александр Юрьевич: Если она ставит по варианту 2 или 3, то ничего менять не нужно
[18:51:25] Va12220(valqwa): у вас там есть где парковаться у дома ?
[18:51:30] Кушелев Александр Юрьевич: Если она ставит по варианту 4, то нужно проверить предыдущие 2. Если все они 1 или 4, то вариант 4 остаётся. Если нет, то превращается в вариант 5.
[18:51:36] Кушелев Александр Юрьевич: Есть
[18:51:48] Va12220(valqwa): )) и дворники чистят дороги ?
[18:52:11] Кушелев Александр Юрьевич: Но если следующий вариант будет 1 или 4, то предыдущий вариант 5 нужно будет вернуть на место :)
[18:52:17] Кушелев Александр Юрьевич: Вроде чистят
[18:53:01] Кушелев Александр Юрьевич: Короче, с логикой рибосомы придётся ещё разобраться...
[18:53:17] Va12220(valqwa): хооршо. описывай логику. и делай описание в примерах
т.е. так:
[18:53:23] Кушелев Александр Юрьевич: Понял
[18:53:48] Va12220(valqwa): "если она ставит по варанту 2 или 3, то не меять ничего" - например: "несколько примеров" в коде
[18:54:08] Va12220(valqwa): и т.д.
[20:01:06] Кушелев Александр Юрьевич: Вроде разобрался.
[20:01:09] Кушелев Александр Юрьевич:
1. Если встречается код 2 или 3, ничего не менять.
2. Если встречается код 1 или 4, запомнить их и поменять на 5.
3. Если второй раз подряд встречается код 1 или 4, замомнить и поменять на 5.
4. Если третий раз подряд встречается код 1 или 4, то в случае 1 запомнить и поменять на 5, а в случае 4 поменять два предыдущих кода на коды "4"
5. Если четвёртый раз подряд встречается код 1 или 4, то если последний код 1, три предыдущих поменять на коды "1". Если последний 4, то ничего не менять.
6. Если больше, чем 4 раза подряд встречается код 1 или 4 или их комбинация, то ничего не менять.
После первого прохода идёт второй:
7. Если встречается код Met, то если он 5, то не менять. Если он 1, то поменять на 6.

[20:21:04] Va12220(valqwa): противоречие 7 и 2
[20:21:21] Кушелев Александр Юрьевич: В чём?
[20:21:46] Va12220(valqwa): 1 который ты уже поменял в 2 на 5
поэтому в 7 не видишь 1
[20:22:07] Кушелев Александр Юрьевич: А в 4 они могут обратно поменяться
[20:22:31] Va12220(valqwa): 4 - особый исключительный случай
[20:22:37] Кушелев Александр Юрьевич: Нет
[20:22:56] Кушелев Александр Юрьевич: 4 случай - это начало альфа- или 310-спирали
[20:22:56] Va12220(valqwa): и что значит "запомнить и поменять"
[20:23:13] Кушелев Александр Юрьевич: Запомнить, чтобы можно было обратно поменять
[20:23:55] Кушелев Александр Юрьевич: А если там больше 3 раз подряд 1 или 4 (или смесь), то тут уже менять ничего не нужно. Это уже спираль продолжается
[20:30:58] Кушелев Александр Юрьевич: Не, это кривой алгоритм. Нужно по-другому.
[20:32:06] Кушелев Александр Юрьевич: 1. Если встретился код 2 или 3, ничего не менять.
2. Если встретился 4, то проверить, что впереди и сзади. Если символ N-1 и N-2 1 или 4, а N-3 2 или 3, то поменять символ N, N-1 и N-2 на 4. Если N-3 1 или 4, то ничего не менять. Если символ N+1 2 или 3, а N-1 или N-2 2 или 3, то символ N поменять на 5.
[20:53:38] Кушелев Александр Юрьевич: 3. Если встретился символ 1, то проверить, что спереди и сзади. Если спереди+сзади меньше 3 символов 1 или 4, символ N поменять на 5.
[20:54:42] Кушелев Александр Юрьевич: Опять как-то криво получается...
[20:56:05] Va12220(valqwa): угу. кривовато.
[20:56:45] Кушелев Александр Юрьевич: Надо включать счётчик символов типа 1 или 4. Если счётчик сбросился с номера 1 или 2 в 0, то поменять 1-2 символа 1 или 4 на 5
[20:56:45] Va12220(valqwa): давай возьмем какую нибудь "показательную" fast" последовательность и её будем разбирать
[20:56:58] Кушелев Александр Юрьевич: Не, лучше с логикой разобраться
[20:57:13] Кушелев Александр Юрьевич: Включаем счётчик на символе 1 или 4
[20:57:15] Va12220(valqwa): если с логикой - то это тебе делать сейчас надо
[20:57:22] Va12220(valqwa): тернируйся
[20:57:46] Кушелев Александр Юрьевич: Если счётчик дошёл до 3 и последний символ 4, то два предыдущих нужно поменять на 4.
[20:58:08] Кушелев Александр Юрьевич: Если счётчик дошёл до 4, то менять ничего не нужно.
[20:58:58] Кушелев Александр Юрьевич: Если счётчик дошёл до 3, и последний символ 1, после чего счётчик сбросился в 0, то все три символа нужно поменять на 5
[20:59:49] Va12220(valqwa): приведи наглядный пример
[21:00:08] Кушелев Александр Юрьевич: Один момент
[21:02:10] Кушелев Александр Юрьевич: 331334331133443314334133 -> 33533533553355335533
[21:02:39] Кушелев Александр Юрьевич: 31113 -> 35553
[21:02:57] Кушелев Александр Юрьевич: 31143 -> 34443
[21:03:21] Кушелев Александр Юрьевич: 34143 -> 34443
[21:03:38] Кушелев Александр Юрьевич: 31443 -> 34443
[21:04:16] Кушелев Александр Юрьевич: 34443 не менять
[21:04:23] Кушелев Александр Юрьевич: 311113 не менять
[21:04:43] Кушелев Александр Юрьевич: 341413 не менять
[21:05:01] Кушелев Александр Юрьевич: 344413 не менять
[21:06:33] Кушелев Александр Юрьевич: Короче, если счётчик единиц (четвёрок) дошёл до 4, то ничего не менять
[21:06:45] Кушелев Александр Юрьевич: Если дошёл до трёх и последняя была 4, то тоже ничего не менять
[21:06:46] Va12220(valqwa): это вот выглядит как-то "странно"
[21:02] Кушелев Александр Юрьевич:

31143 -> 34443
34143 -> 34443
31443 -> 34443 не получится ли, что последующие геометрические преобразования приведут к неверному виду? оч даже получится.

и я не вижу в втоем примере счетчик
[21:07:24] Кушелев Александр Юрьевич: Счётчик считает 1 и 4
[21:07:37] Va12220(valqwa): и ты брал в качестве рассматриваемых отрезков - отрезки по 5 цифр ПОСЛЕДОВАТЕЛЬНО
а если внутри таких отрезков есть правила что ты ранее говорил ?
[21:07:39] Кушелев Александр Юрьевич: Если досчитал до тёх и последний символ 4, то ничего не менять
[21:08:05] Кушелев Александр Юрьевич: Если достчитал до 4, то ничего не менять.
[21:08:30] Кушелев Александр Юрьевич: Если досчитал до трёх, последняя 1 и счётчик сбросился, то менять на 555
[21:09:02] Кушелев Александр Юрьевич: Если счётчик сбросился после двух, то менять на 55
[21:09:15] Кушелев Александр Юрьевич: Если счётчик сбросился после одного символа, то менять на 5
[21:09:30] Va12220(valqwa): экселем умеешь пльзоваться ?
[21:09:36] Кушелев Александр Юрьевич: Неа
[21:09:58] Кушелев Александр Юрьевич: Зато с логикой алгоритма практически прояснилось
[21:10:15] Кушелев Александр Юрьевич: Нужно завести счётчик символов 1(4)
[21:10:32] Кушелев Александр Юрьевич: И сбрасывать его символом 2(3)
[21:12:13] Va12220(valqwa): не понимаю я того что ты пишешь.
вот последовательность(верх) и счетчики снизу
1111141411411411344213
1234 - сейчас последняя 1 - что мне менять на 555 ?
[21:12:14] Кушелев Александр Юрьевич: Кстати, этот алгоритм можно и в скрипт Кушелева встроить.
[21:13:08] Кушелев Александр Юрьевич: Если счётчик не сбросился после третьей единицы, то уже ничего не менять.
[21:13:25] Va12220(valqwa): а почему он не сбросился после 3й единицы ?
[21:13:40] Кушелев Александр Юрьевич: А потому что у тебя 4-ый символ не 2 и не 3
[21:16:16] Кушелев Александр Юрьевич: А если он сбросился после третьего символа, и он оказался "1", то все три нужно менять на 555, а если третий был 4, но все менять на 444
[21:16:19] Va12220(valqwa): хорошо
дальше
1111141411411411344213
1234123
1234_сбрасывание счетчика в 1(см выше)
[21:16:29] Va12220(valqwa): дальше как быть?
[21:17:24] Va12220(valqwa): по-твоему я сбрасываю счеткик после 4ки или после встреченного кода 2 или 3
[21:17:26] Кушелев Александр Юрьевич: Дальше начинаем считать с ближайшей 1 или 4
[21:17:54] Кушелев Александр Юрьевич: Сбрасывать надо на 2 или 3
[21:17:56] Va12220(valqwa): 1111141411411411344213
1234
распиши дальше ступеньчато
[21:18:56] Кушелев Александр Юрьевич: 1111141411411411344213
123456789... на тройке будет 0
[21:19:17] Кушелев Александр Юрьевич: После тройки начинаем сначала:
[21:19:45] Кушелев Александр Юрьевич: 344213
012010
[21:20:32] Кушелев Александр Юрьевич: 344213 -> 355253
[21:21:30] Va12220(valqwa): а теперь посмотри на свою картинку

Изображение

последовательность из неё взята
[21:22:01] Кушелев Александр Юрьевич: На втором проходе Met нужно будет с 1 на 6 поменять
[21:22:32] Va12220(valqwa): там 2 мета ! а менять надо в 1м случае ?
[21:22:54] Кушелев Александр Юрьевич: Не понял. Что за 2 мета?
[21:23:13] Va12220(valqwa): там второй и 4й единичке соответствует МЕТ
[21:23:20] Кушелев Александр Юрьевич: Оба
[21:23:22] Va12220(valqwa): а ты меняешь на 6 только вторую на картинке
[21:23:31] Кушелев Александр Юрьевич: Я первый не заметил
[21:23:37] Кушелев Александр Юрьевич: Он и не имеет значения
[21:23:46] Кушелев Александр Юрьевич: Но по алгоритму надо менять оба
[21:23:51] Va12220(valqwa): все имеет значение.
[21:24:23] Кушелев Александр Юрьевич: Менять, менять...
[21:24:53] Кушелев Александр Юрьевич: На самом деле первый символ не имеет смысла
[21:26:05] Va12220(valqwa): второй на твоей картинке
[21:26:11] Va12220(valqwa): второй МЕТ там
[21:26:15] Кушелев Александр Юрьевич: А хотя ... тут не всё так просто...
[21:26:40] Кушелев Александр Юрьевич: Второй точно надо менять
[21:27:16] Кушелев Александр Юрьевич: Начало белка погоды не делает. Поэтому лучше пусть по общему алгоритму будет

[21:46:37] Va12220(valqwa): ну давай попробуем.
фаст последовательность какую взять ?
[21:46:57] Кушелев Александр Юрьевич: момент
[21:47:12] Кушелев Александр Юрьевич: FT CDS 1..492
ATGGAAGCTA GGAGCCGGGC TCCCAGAAGA CAGCTGTGCC CGCCTGGGAT CACTTGGCTG
GCCCTGGCCT ATCTGCTCAG CTGCCTGCTT GCCTCCAGCA AGGCCAAGGT CTTCAGTCGC
TGTGAGCTGG CCAAAGAGAT GCATGACTTC GGTCTGGATG GCTACCGGGG TTATAACCTG
GCTGACTGGG TCTGCCTTGC TTACTACACA AGTGGCTTCA ACACAAATGC TGTGGATCAT
GAAGCTGATG GAAGCACCAA CAATGGCATC TTCCAGATCA GCAGCCGGAG GTGGTGCAGA
ACCCTCGCCT CGAATGGCCC CAATCTTTGC AGGATATACT GCACTGATTT GTTGAACAAT
GATCTCAAAG ATTCTATCGT CTGTGCCATG AAGATAGTTC AAGAACCCCT GGGTCTGGGC
TATTGGGAAG CCTGGAGGCA CCACTGCCAG GGCAGGGACC CCAGTGACTG GGTGGATGGC
TGTGACTTCT AG
//
[21:47:26] Кушелев Александр Юрьевич: Это dne
[21:48:20] Кушелев Александр Юрьевич: А это fasta:
[21:48:21] Кушелев Александр Юрьевич: >ENA|AAS77887|AAS77887.1 Mus musculus (house mouse) lysozyme-like protein 3
ATGGAAGCTAGGAGCCGGGCTCCCAGAAGACAGCTGTGCCCGCCTGGGATCACTTGGCTG
GCCCTGGCCTATCTGCTCAGCTGCCTGCTTGCCTCCAGCAAGGCCAAGGTCTTCAGTCGC
TGTGAGCTGGCCAAAGAGATGCATGACTTCGGTCTGGATGGCTACCGGGGTTATAACCTG
GCTGACTGGGTCTGCCTTGCTTACTACACAAGTGGCTTCAACACAAATGCTGTGGATCAT
GAAGCTGATGGAAGCACCAACAATGGCATCTTCCAGATCAGCAGCCGGAGGTGGTGCAGA
ACCCTCGCCTCGAATGGCCCCAATCTTTGCAGGATATACTGCACTGATTTGTTGAACAAT
GATCTCAAAGATTCTATCGTCTGTGCCATGAAGATAGTTCAAGAACCCCTGGGTCTGGGC
TATTGGGAAGCCTGGAGGCACCACTGCCAGGGCAGGGACCCCAGTGACTGGGTGGATGGC
TGTGACTTCTAG
[21:49:04] Va12220(valqwa): оки. хорошо. сейчас минут 10-20 повожусь. настрою
[21:49:27] Кушелев Александр Юрьевич: Эти шутники всё время стандарты расширяют. Появились новые "фасты", которые программа от Prosolver не понимает
[21:52:51] Va12220(valqwa): мне все равно
[21:54:58] Кушелев Александр Юрьевич: Вот такую фасту программа Prosolver не берёт:
[21:54:59] Кушелев Александр Юрьевич: >NM_014656.2 Homo sapiens KIAA0040 (KIAA0040), transcript variant 2, mRNA
TCCCACGACCTTGGCCGGCGCCGGGGCCCTACACGCCAGACCTGGCTCGGGGTGGGAGTGCAGAGGCAAC
CAAAAAGGAACCCACACCTCCCTCCAGGGCCCGGGGCGCTGTCAGACGGGGCAGCAACCAGGAGATTCCC
[21:55:21] Кушелев Александр Юрьевич: Говорит, что ей не хватает ENA<
[21:56:05] Кушелев Александр Юрьевич: Ты можешь подправить программу, чтобы она первую строчку игнорировала, но брала оттуда название файла
[21:56:11] Кушелев Александр Юрьевич: Точнее название белка
[21:56:18] Кушелев Александр Юрьевич: Идентификатор
[21:56:38] Кушелев Александр Юрьевич: Или первые символов 30. Там он точно будет
[21:57:33] Кушелев Александр Юрьевич: Можно даже всю первую строчку загнать в графический файл, но только разбить на короткие строчки, чтобы графический файл шире не стал.
[21:59:13] Va12220(valqwa): сейчас не могу. у меня нет сейчас оболочки паскаля что бы разбираться с паскалем (старым очень к тому же )
[22:01:10] Va12220(valqwa): это нужно же заново потом перекомпилировать и создать исполняемый файл. гемороя хватит не на один час и не на два )
[22:02:06] Va12220(valqwa): если тебе так важно, то мне проще сделать тоже самое
https://img-fotki.yandex.ru/get/198998/158289418.3c1/0_17066a_325fac7_orig.png
на своем инструменте
[22:03:59] Кушелев Александр Юрьевич: Мне без разницы, на каком. Важно исходный алгоритм зафиксировать, чтобы можно было в скрипт Кушелева встроить. Тогда я смогу на Маше продублировать всё.
[22:04:45] Va12220(valqwa): не понял. что в маше продублировать ?
[22:04:58] Кушелев Александр Юрьевич: Алгоритм превращения 1234 в 123456
[22:05:26] Кушелев Александр Юрьевич: У меня сейчас скрипт строит 3D модель без радикалов по композиционному коду
[22:05:40] Кушелев Александр Юрьевич: Я на нём могу углы настраивать для вариантов 123456
[22:06:03] Кушелев Александр Юрьевич: Но в моём скрипте нет алгоритма перекодировки 1234 в 123456
[22:06:11] Va12220(valqwa): а какой "исходный" ?
[22:06:25] Кушелев Александр Юрьевич: Ты же в своей программе его делаешь?
[22:06:41] Va12220(valqwa): твой алгоритм берет композиционный код ?
[22:06:41] Кушелев Александр Юрьевич: Вот и в скрипт его хорошо бы тоже вставить
[22:06:46] Кушелев Александр Юрьевич: Да
[22:06:56] Кушелев Александр Юрьевич: И строит кольцегранную модель без радикалов
[22:07:09] Va12220(valqwa): и он сейчас берет 1234
а ты хочешь получить комп код 123456
и уже с ним работать ?
[22:07:34] Кушелев Александр Юрьевич: Да, но я хочу и алгоритм в скрипт вставить, чтобы он сам из 1234 делал 123456
[22:07:54] Va12220(valqwa): ну вставь - ты же мне его рассказал только что
[22:08:10] Кушелев Александр Юрьевич: Я его не могу в виде скрипта написать
[22:08:25] Va12220(valqwa): а как собрался тогда вставлять ?
[22:08:49] Кушелев Александр Юрьевич: Глядя на твой исходник может получится его в виде скрипта написать
[22:10:01] Va12220(valqwa): ну ну
[22:10:03] Кушелев Александр Юрьевич: Скрипт хорош тем, что я его могу модифицировать сам
[22:10:38] Кушелев Александр Юрьевич: Не нужно будет ждать твоего очередного возвращения, чтобы исправить 20 градусов на 22 градуса или наоборот
[22:11:35] Кушелев Александр Юрьевич: А после того, как наберётся критическое количество доработок, ты уже новую версию напишешь
[22:12:22] Va12220(valqwa): давай попробуем
[22:12:31] Кушелев Александр Юрьевич: Давай
[22:13:54] Кушелев Александр Юрьевич: Кстати, мне от программы Prosolver нужно в первую очередь код 123456, а не графика
[22:14:02] Кушелев Александр Юрьевич: Графика она такой же останется
[22:14:11] Кушелев Александр Юрьевич: Тольцо цифры в столбцах поменяются
[22:14:27] Кушелев Александр Юрьевич: Для скрипта мне только цифры и нужны
[22:14:47] Кушелев Александр Юрьевич: В виде текстового файла
[22:15:34] Кушелев Александр Юрьевич: Но чтобы две программы не запускать, хотелось бы и цветные столбцы видеть сразу

[22:19:07] Va12220(valqwa): так как на картинке ?
[22:20:51] Кушелев Александр Юрьевич: Да, но два столбца там не нужно. Только новый с новыми цифрами. Хотя для проверки может и старый пригодиться...
[22:21:09] Кушелев Александр Юрьевич: После отладки старый будет не нужен
[22:22:25] Va12220(valqwa): но для 5 и 6 видимо должны быть иные обозначения в цветных столбцаХ?
[22:23:08] Кушелев Александр Юрьевич: Да. Они и были раньше. 5 был розовым, а 6 нужно сделать сиреневым
[22:23:38] Va12220(valqwa): а размер - полный прямоугольник ?
[22:23:53] Кушелев Александр Юрьевич: А размер оставить, как был
[22:24:00] Va12220(valqwa): а я не знаю какой он был
[22:24:11] Кушелев Александр Юрьевич: Так у тебя же картинка есть
[22:24:35] Va12220(valqwa): на картнке 6 - полный а 5 - половинный ТАК ?
[22:25:25] Кушелев Александр Юрьевич: Розовый пусть будет другой формы вообще. Сейчас нарисую
[22:29:38] Кушелев Александр Юрьевич: Розовый нужно сделать из зелёного. Т.е. такой же формы, как зелёный, только розовый
[22:29:51] Кушелев Александр Юрьевич: Сможешь?
[22:31:11] Кушелев Александр Юрьевич: Розовый на самом деле должен быть красно-розовым
[22:31:25] Кушелев Александр Юрьевич: Яркая часть средняя красная, а окантовочка розовая.
[22:32:04] Кушелев Александр Юрьевич: Из зелёного в Фотошопе перекрасить изменением оттенка
[22:32:25] Кушелев Александр Юрьевич: У меня просто фотошопа нет
[22:32:34] Кушелев Александр Юрьевич: Не тянет этот комп...
[22:34:07] Va12220(valqwa): )) в маше нарисуй ;)
[22:35:14] Кушелев Александр Юрьевич: Ддразниться? Замени цифры в Color cо второй позиции(зеленый) на первую (красный), и всех делов
[22:38:08] Va12220(valqwa): ладно. нарисую конечно.
отдыхай пока что ) можно сказать день не зря прожит.
[22:38:31] Кушелев Александр Юрьевич: Да. Алгоритм нарисовался, однако...

[22:41:02] Va12220(valqwa): я сейчас беру
>ENA|AAS77887|AAS77887.1 Mus musculus (house mouse) lysozyme-like protein 3
ATGGAAGCTAGGAGCCGGGCTCCCAGAAGACAGCTGTGCCCGCCTGGGATCACTTGGCTG
GCCCTGGCCTATCTGCTCAGCTGCCTGCTTGCCTCCAGCAAGGCCAAGGTCTTCAGTCGC
TGTGAGCTGGCCAAAGAGATGCATGACTTCGGTCTGGATGGCTACCGGGGTTATAACCTG
GCTGACTGGGTCTGCCTTGCTTACTACACAAGTGGCTTCAACACAAATGCTGTGGATCAT
GAAGCTGATGGAAGCACCAACAATGGCATCTTCCAGATCAGCAGCCGGAGGTGGTGCAGA
ACCCTCGCCTCGAATGGCCCCAATCTTTGCAGGATATACTGCACTGATTTGTTGAACAAT
GATCTCAAAGATTCTATCGTCTGTGCCATGAAGATAGTTCAAGAACCCCTGGGTCTGGGC
TATTGGGAAGCCTGGAGGCACCACTGCCAGGGCAGGGACCCCAGTGACTGGGTGGATGGC
TGTGACTTCTAG
и начинаю с ним работать,
сначала получаю 4х кодовый вариант
и затем его перевожу в 6ти кодовый

и тебе пересылаю 2 текстовых файла последовательностей.
[22:42:18] Кушелев Александр Юрьевич: ОК
[22:43:12] Кушелев Александр Юрьевич: Может лучше сразу с графическим файлом сделать. Тогда легче будет проверять
[22:43:29] Кушелев Александр Юрьевич: Ну и полосочки цветные настроение поднимают...
[22:44:24] Va12220(valqwa): извини. все по очереди.
4->6 мне надо сейчас запрограммировать.
а потом "навесить" картинку будет легче
[22:44:36] Кушелев Александр Юрьевич: Давай так
[22:52:03] Va12220(valqwa): цифры должны идти без пробелов ?
[22:52:56] Кушелев Александр Юрьевич: вместо пробелов нужны запятые
[22:53:17] Va12220(valqwa): момент
[22:53:27] Кушелев Александр Юрьевич: И в строке 30 цифр и 30 запятых
[22:54:35] Va12220(valqwa): тогда пару моментов )
[22:56:42] Кушелев Александр Юрьевич: 1,1,1,1,1,1,1,1,1,1,4,1,1,1,1,1,3,1,1,3,2,4,1,1,1,1,1,3,1,1,4,4,3,1,1,1,1,1,4,3,3,1,4,4,4,2,3,1,3,1,
1,1,3,3,3,3,4,1,3,1,3,1,3,1,3,3,1,1,1,1,4,1,4,2,1,3,1,1,1,1,3,3,1,3,2,4,3,4,1,3,1,1,1,4,3,1,1,1,4,3,
3,1,1,1,3,1,2,2,1,1,1,1,4,1,1,1,1,1,2,2,1,1,3,1,3,1,1,3,1,3,3,1,2,1,3,1,3,1,3,3,1,3,3,1,1,1,3,4,3,1,
1,1,1,3,3,3,3,1,1,1,1,3,3,1,4,1,1,1,4,1,1,3,1,1,1,4,1,3,2,1,1,4,1,1,1,2,3,1,3,3,1,1,3,3,3,3,1,3,3,4,
4,1,1,1,1,2,4,1,3,1,3,1,1,1,2,1,1,3,1,1,3,3,3,1,1,1,4,3,3,1,1,4,1,1,3,1,3,4,3,1,3,2,1,1,4,2,3,1,1,1,
1,1,3,3,1,3,3,1,1,4,1,3,1,3,4,1,1,3,1,1,1,1,1,4,1,1,3,1,1,3,1,3,1,2
[22:56:51] Кушелев Александр Юрьевич: Такой примерно вид
[22:56:57] Va12220(valqwa): я понял
[22:57:16] Кушелев Александр Юрьевич: Я этот код прямо в скрипт вставляю

Пикотехнология белков, ДНК, РНК - 2

Изображение

Кушелев: Любопытный фрагмент лизоцима (альтернативный человеческий). Met 30 - Cys 31. Интересно, могут ли соединиться дисульфидным мостиком радикалы этих соседних аминокислотных остатков? :)

Пикотехнология белков, ДНК, РНК - 2

Skype, 2017-01-16:

[15.01.2017 23:33:28] Va12220(valqwa): а так прочтешь ?

1,3,3,1,1,4,3,1,3,3,1,4,1,4,3,4,1,3,1,4,1,4,1,3,4,1,1,1,4,3,1,1,1,1,1,1,1,1,3,1,3,1,4,1,3,1,1,3,1,1,
3,4,3,1,1,4,3,3,1,4,3,1,1,1,1,3,3,1,1,2,3,1,1,1,2,3,3,4,3,3,3,3,3,2,1,1,1,3,1,1,1,1,1,1,1,4,1,1,1,3,
1,1,1,4,3,1,1,3,3,1,1,2,1,1,3,3,1,1,1,3,3,1,3,3,3,1,1,3,1,1,1,2,3,3,3,1,4,3,4,1,3,1,3,1,1,1,1,1,1,1,
1,1,1,1,3,1,1,4,3,1,3,1,1,

[15.01.2017 23:35:19] Va12220(valqwa): ктсати в твоем "примере" в строке не 30 цифр а 50!
[15.01.2017 23:37:19] Кушелев Александр Юрьевич: Годится!
[15.01.2017 23:37:33] Кушелев Александр Юрьевич: Можно и 50 сделать
[15.01.2017 23:37:37] Va12220(valqwa): там в конце запятая - она не мешает ?
[15.01.2017 23:37:40] Кушелев Александр Юрьевич: 50 даже удобнее будет
[15.01.2017 23:37:47] Кушелев Александр Юрьевич: Не, не мешает
[15.01.2017 23:38:12] Va12220(valqwa): хорошо. исправлю на 50 символов в строке
[15.01.2017 23:38:17] Кушелев Александр Юрьевич: ОК

1,3,3,1,1,4,3,1,3,3,1,4,1,4,3,4,1,3,1,4,1,4,1,3,4,1,1,1,4,3,1,1,1,1,1,1,1,1,3,1,3,1,4,1,3,1,1,3,1,1,
3,4,3,1,1,4,3,3,1,4,3,1,1,1,1,3,3,1,1,2,3,1,1,1,2,3,3,4,3,3,3,3,3,2,1,1,1,3,1,1,1,1,1,1,1,4,1,1,1,3,
1,1,1,4,3,1,1,3,3,1,1,2,1,1,3,3,1,1,1,3,3,1,3,3,3,1,1,3,1,1,1,2,3,3,3,1,4,3,4,1,3,1,3,1,1,1,1,1,1,1,
1,1,1,1,3,1,1,4,3,1,3,1,1,

[15.01.2017 23:42:58] Va12220(valqwa): 4х кодовый файл будет таким
[15.01.2017 23:43:10] Va12220(valqwa): сейчас займусь перекодировкой в 6ти кодовый вариант
[0:13:36] Va12220(valqwa): 344213
012010
344213 -> 355253
тут вторая пятерка не описана у тебя никакой логикой ранее
получается что после 0 (на двойке) идет 1 - ей счетчик 1
затем идет тройка - обнуление счетчика
НО! счетчик не 2 и не 3 - т.е. нету комбинации что ты ранее описал
а ты ранее описывал что меняются на 5ки только если счетчик 2 или 3

и это касается как 1 так и 4к
[0:19:19] Кушелев Александр Юрьевич: Не
[0:20:26] Кушелев Александр Юрьевич: Если счётчик обнуляется на следующем символе (N+1), то 1 и 4 превращаются в пятёрки. Если на N+2 тоже
[0:21:37] Кушелев Александр Юрьевич: Если N+3, то N, N+1 и N+2 становятся четверками, если N+2 четверка и пятерками, если 1
[0:22:30] Va12220(valqwa): т.е. важно срабатывание обнуления после 1го, 2х, или 3х кодовых цифр
а после 4х и далее уже не важно и замен не делается.
[0:22:43] Кушелев Александр Юрьевич: Да
[0:22:50] Va12220(valqwa): момент - исправлю чуток
[0:40:55] Va12220(valqwa): а теперь посмотри

>ENA|AAS77887|AAS77887.1 Mus musculus (house mouse) lysozyme-like protein 3
ATGGAAGCTAGGAGCCGGGCTCCCAGAAGACAGCTGTGCCCGCCTGGGATCACTTGGCTG
GCCCTGGCCTATCTGCTCAGCTGCCTGCTTGCCTCCAGCAAGGCCAAGGTCTTCAGTCGC
TGTGAGCTGGCCAAAGAGATGCATGACTTCGGTCTGGATGGCTACCGGGGTTATAACCTG
GCTGACTGGGTCTGCCTTGCTTACTACACAAGTGGCTTCAACACAAATGCTGTGGATCAT
GAAGCTGATGGAAGCACCAACAATGGCATCTTCCAGATCAGCAGCCGGAGGTGGTGCAGA
ACCCTCGCCTCGAATGGCCCCAATCTTTGCAGGATATACTGCACTGATTTGTTGAACAAT
GATCTCAAAGATTCTATCGTCTGTGCCATGAAGATAGTTCAAGAACCCCTGGGTCTGGGC
TATTGGGAAGCCTGGAGGCACCACTGCCAGGGCAGGGACCCCAGTGACTGGGTGGATGGC
TGTGACTTCTAG

Код 4:
1,3,3,1,1,4,3,1,3,3,1,4,1,4,3,4,1,3,1,4,1,4,1,3,4,1,1,1,4,3,1,1,1,1,1,1,1,1,3,1,3,1,4,1,3,1,1,3,1,1,
3,4,3,1,1,4,3,3,1,4,3,1,1,1,1,3,3,1,1,2,3,1,1,1,2,3,3,4,3,3,3,3,3,2,1,1,1,3,1,1,1,1,1,1,1,4,1,1,1,3,
1,1,1,4,3,1,1,3,3,1,1,2,1,1,3,3,1,1,1,3,3,1,3,3,3,1,1,3,1,1,1,2,3,3,3,1,4,3,4,1,3,1,3,1,1,1,1,1,1,1,
1,1,1,1,3,1,1,4,3,1,3,1,1,

Код 6:
1,3,3,5,5,5,3,1,3,3,1,4,1,4,3,5,5,3,1,4,1,4,1,3,4,1,1,1,4,3,1,1,1,1,1,1,1,1,3,1,3,5,5,5,3,5,5,3,5,5,
3,4,3,5,5,5,3,3,5,5,3,1,1,1,1,3,3,5,5,2,3,5,5,5,2,3,3,4,3,3,3,3,3,2,5,5,5,3,1,1,1,1,1,1,1,4,1,1,1,3,
1,1,1,4,3,5,5,3,3,5,5,2,5,5,3,3,5,5,5,3,3,1,3,3,3,5,5,3,5,5,5,2,3,3,3,5,5,3,5,5,3,1,3,1,1,1,1,1,1,1,
1,1,1,1,3,5,5,5,3,1,3,1,1,

[0:43:59] Кушелев Александр Юрьевич: Вроде нормально
[0:44:00] Va12220(valqwa): осталось "приклеить" проверку на МЕТ
[0:44:53] Кушелев Александр Юрьевич: Да. Если он после первого преобразования стал 5, то пусть и остаётся 5. Если остался 1, то должен стать 6
[0:49:40] Va12220(valqwa): Met это группа atg
встречается во всем перечне только один раз
[0:52:27] Кушелев Александр Юрьевич: Да
[0:53:43] Кушелев Александр Юрьевич: Для теста можно модифицировать входной файл, чтобы там было несколько Met

[1:10:40] Va12220(valqwa):
6,3,3,5,5,5,3,1,3,3,1,4,1,4,3,5,5,3,1,4,1,4,1,3,4,1,1,1,4,3,1,1,1,1,1,1,1,1,3,1,3,5,5,5,3,5,5,3,5,5,
3,4,3,5,5,5,3,3,5,5,3,1,1,1,1,3,3,5,5,2,3,5,5,5,2,3,3,4,3,3,3,3,3,2,5,5,5,3,1,1,1,1,1,1,1,4,1,1,1,3,
1,1,1,4,3,5,5,3,3,5,5,2,5,5,3,3,5,5,5,3,3,1,3,3,3,5,5,3,5,5,5,2,3,3,3,5,5,3,5,5,3,1,3,1,1,1,1,1,1,1,
1,1,1,1,3,5,5,5,3,1,3,1,1,

[1:12:54] Кушелев Александр Юрьевич: Отлично! Пора делать цветные полоски :)
[1:13:03] Va12220(valqwa): "приклеил" 6-ку.

в данном тестовом файле она на 1м месте
хотя вообще то Мет встречается в файле 3 раза
1 45 и 130е
[1:13:50] Кушелев Александр Юрьевич: И там он под номером 5 ?
[1:16:49] Va12220(valqwa): 1 - 6-ка
остальные не смотрел. видимо 5 - у меня проверка на 1ку поставлена.
сейчас проверю
1-47-130
[1:16:58] Va12220(valqwa): да. там 5ки (47е и 130е место
[1:17:35] Кушелев Александр Юрьевич: Отлично
[1:17:48] Кушелев Александр Юрьевич: Когда сможешь с цветными полосками сделать?
[1:18:15] Va12220(valqwa): сейчас и вожусь
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#10 Kushelev » 16.01.2017, 10:19

Изображение

Добавлено спустя 2 минуты 21 секунду:
Изображение

Добавлено спустя 21 минуту 47 секунд:
Изображение
Подробнее: http://nanoworld.narod.ru/129.htm

Добавлено спустя 48 секунд:
Изображение
Подробнее: http://nanoworld88.narod.ru/data/325.htm
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#11 Мукай Кусуй » 16.01.2017, 12:20

Хороший сказочки
Мукай Кусуй
Аватара
Репутация: 57 (+57/−0)
Лояльность: -2
Сообщения: 86
Темы: 4
Зарегистрирован: 24.11.2016
С нами: 1 месяц 27 дней

#12 Kushelev » 17.01.2017, 04:08

Изображение
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#13 Kushelev » 17.01.2017, 19:01

Формы, механизмы, энергия наномира. Сообщение 84 575

Пикотехнология белков, ДНК, РНК - 2

Открыт новый тип белковой структуры!

http://nanoworld.org.ru/post/82432/#p82432

>NM_207361.5 Homo sapiens FRAS1 related extracellular matrix protein 2 (FREM2), mRNA
GGGATTTCCCTCAAAGCCCAGGGTCCGGGGACCTGGAAAGTAGAAGTGGAGGGATTCAATTCTCCGCGCG
ATTGAGGCGCTAGCGGCGGAGCTGGACGGCCTGGGAAGGCTTCGGCTCCTCGGCTGCGGCTCCAGCCCGG
ACGGCGCCGCGCAACTTTGCCATCCTTCTGGCCCAGCCCCGGCTACAGGAGGACCCCGCGGGCAACGCGC
GGAGTTCCTGGCACTTCCCGGCGGTGTCTCTTGTTGTCTGCCCGGGGACCGACTTCGCATGCTCTCAGGC
TGACCTGTCCAAGCCCGAACACCGGGACCATGCACTCAGCCGGGACTCCCGGGTTATCCTCGCGCCGGAC
AGGCAACTCCACCAGCTTTCAACCAGGACCGCCACCGCCGCCCCGGCTGCTGCTGCTGCTGCTGCTTCTC
CTGTCACTGGTAAGCCGCGTCCCGGCACAGCCCGCTGCCTTCGGCAGGGCGTTGCTGTCCCCTGGTCTCG
CGGGGGCTGCAGGGGTCCCTGCTGAGGAGGCCATAGTGCTGGCGAACCGCGGACTCCGGGTGCCTTTCGG
CCGTGAAGTCTGGCTGGATCCCCTGCATGACCTGGTGTTGCAGGTGCAGCCCGGGGACCGCTGCGCGGTT
TCGGTACTAGACAACGACGCACTGGCCCAGCGACCGGGCCGCCTGAGTCCCAAGCGCTTCCCGTGCGACT
TTGGCCCTGGCGAGGTGCGCTACTCTCACCTGGGCGCGCGCAGCCCGTCTCGGGACCGCGTCCGGCTGCA
GCTGCGCTATGACGCGCCCGGAGGGGCAGTAGTGCTACCACTGGTACTGGAGGTGGAGGTGGTCTTCACC
CAGCTGGAGGTTGTGACTCGGAACTTGCCTCTGGTCGTGGAAGAGCTGCTGGGGACCAGCAATGCCCTGG
ACGCGCGGAGCCTGGAGTTCGCCTTCCAGCCCGAGACAGAGGAGTGCCGCGTGGGCATCCTGTCCGGCTT
GGGCGCGCTGCCTCGCTATGGAGAACTCCTCCACTACCCGCAGGTCCCTGGAGGAGCCAGAGAGGGAGGC
GCCCCGGAGACTCTCCTGATGGACTGCAAAGCTTTCCAGGAACTAGGCGTGCGCTATCGCCACACAGCCG
CCAGTCGCTCACCAAACAGGGACTGGATACCCATGGTGGTGGAGCTGCGTTCACGAGGGGCTCCTGTGGG
CAGCCCTGCTTTGAAACGCGAGCACTTCCAGGTTCTGGTGAGGATCCGAGGAGGGGCCGAGAACACTGCA
CCCAAGCCCAGTTTCGTGGCCATGATGATGATGGAGGTGGACCAGTTTGTACTGACGGCCCTGACCCCAG
ACATGCTGGCAGCCGAGGATGCTGAGTCTCCCTCTGACCTGTTGATCTTCAACCTTACTTCTCCATTCCA
GCCTGGCCAGGGCTACTTGGTGAGCACCGATGATCGCAGCCTGCCCCTTTCCTCCTTCACTCAGAGGGAT
CTGCGGCTCCTGAAGATTGCCTACCAGCCCCCTTCTGAAGACTCTGACCAGGAGCGCCTCTTTGAACTGG
AATTGGAGGTAGTGGATCTAGAAGGAGCAGCTTCAGACCCTTTTGCCTTCATGGTAGTGGTGAAGCCCAT
GAACACAATGGCTCCGGTGGTCACCCGGAATACCGGTCTTATTCTCTATGAGGGTCAGTCTCGGCCCCTC
ACAGGCCCTGCAGGCAGTGGTCCGCAAAACTTGGTCATCAGCGATGAGGATGACCTAGAAGCAGTGCGGC
TAGAGGTGGTGGCTGGGCTCCGGCATGGTCACCTTGTCATTCTGGGTGCTTCCAGTGGCAGCTCTGCTCC
CAAGAGCTTTACAGTGGCTGAGCTGGCAGCCGGCCAGGTGGTCTACCAGCATGATGACAGAGACGGCTCG
CTGAGCGACAACCTGGTGCTTCGCATGGTGGATGGAGGAGGCAGGCACCAGGTACAGTTTCTGTTCCCCA
TCACCTTAGTGCCTGTGGATGACCAGCCACCTGTTCTCAATGCCAACACGGGGCTGACACTGGCAGAGGG
TGAAACAGTGCCCATCCTGCCCCTTTCCCTGAGTGCAACTGACATGGATTCAGATGATTCTCTGCTGCTT
TTTGTGCTGGAGTCACCCTTCTTAACTACGGGGCATCTGCTTCTCCGCCAAACTCACCCTCCCCATGAGA
AGCAGGAACTTCTCAGAGGCCTTTGGAGGAAGGAGGGGGCATTTTATGAGCGAACAGTGACAGAGTGGCA
GCAGCAGGACATAACAGAGGGCAGGCTGTTCTATAGACACTCTGGGCCCCATAGTCCTGGGCCAGTCACA
GACCAGTTCACATTTAGAGTCCAGGATAACCATGACCCTCCTAATCAGTCCGGGCTACAGCGGTTTGTGA
TTCGTATCCATCCTGTGGATCGCCTCCCTCCGGAGCTGGGCAGTGGCTGTCCCCTTCGTATGGTGGTACA
GGAATCCCAGCTCACACCACTGAGGAAGAAGTGGCTGCGCTACACTGACCTGGACACAGATGACCGAGAA
CTACGTTACACAGTGACTCAGCCCCCCACAGACACAGACGAAAATCACCTGCCAGCCCCACTGGGTACCT
TGGTCTTGACTGACAACCCCTCAGTCGTGGTGACCCATTTTACCCAAGCCCAGATCAACCATCATAAAAT
TGCTTACAGACCCCCGGGTCAAGAACTGGGCGTGGCTACTCGAGTGGCCCAGTTCCAGTTCCAGGTGGAA
GACCGAGCTGGGAATGTGGCTCCAGGTACCTTTACCCTTTACTTGCATCCCGTGGACAACCAGCCACCTG
AGATCCTCAACACCGGCTTCACTATTCAGGAGAAGGGTCACCACATCCTGAGTGAGACAGAGTTGCACGT
GAATGATGTAGACACTGATGTTGCCCATATCTCTTTCACTCTCACTCAGGCACCCAAACATGGCCACATG
AGAGTGTCTGGACAGATCCTGCATGTAGGGGGTCTCTTCCACTTGGAGGACATAAAACAGGGCCGAGTTT
CCTATGCCCATAATGGGGACAAGTCCCTGACTGATAGCTGCTCCTTGGAAGTCAGTGACAGACATCATGT
GGTGCCCATCACTCTCAGAGTAAATGTCCGGCCAGTGGATGATGAAGTGCCCATACTGAGCCATCCTACT
GGCACTCTGGAGTCCTATCTAGATGTCTTAGAAAATGGGGCTACTGAAATCACTGCCAATGTTATTAAGG
GGACCAATGAGGAAACTGATGACTTGATGTTGACTTTCCTCTTGGAAGATCCACCTTTGTATGGGGAAAT
CTTGGTCAATGGCATTCCAGCAGAGCAGTTTACTCAAAGGGACATCTTGGAGGGCTCTGTTGTATATACC
CACACCAGTGGTGAGATAGGCCTATTGCCTAAAGCGGATTCTTTTAACCTGAGTCTGTCAGATATGTCTC
AAGAATGGAGAATTGGTGGCAATACTATCCAAGGAGTTACTATATGGGTGACCATCCTGCCTGTTGATAG
CCAGGCCCCAGAAATCTTTGTAGGTGAACAGTTGATAGTAATGGAAGGTGATAAAAGTGTTATAACATCA
GTGCATATAAGTGCTGAAGATGTCGACTCCCTGAATGATGACATCTTGTGCACTATAGTTATTCAGCCTA
CTTCAGGTTATGTTGAAAACATTTCTCCAGCACCAGGCTCTGAGAAATCAAGAGCAGGGATTGCCATAAG
TGCTTTCAACTTGAAAGATCTCAGGCAGGGCCACATAAACTATGTCCAGAGTGTCCATAAAGGGGTGGAA
CCTGTGGAGGACCGATTTGTATTTCGTTGTTCTGATGGCATTAACTTTTCAGAGAGACAGTTCTTCCCCA
TTGTAATCATTCCCACCAATGATGAACAGCCAGAGATGTTTATGAGAGAATTTATGGTGATGGAAGGCAT
GAGTCTGGTAATTGATACACCCATTCTCAATGCTGCTGATGCTGATGTTCCCCTGGATGATTTAACTTTC
ACTATTACCCAATTCCCCACTCATGGTCACATCATGAATCAGCTGATAAATGGCACGGTTTTGGTCGAAA
GCTTCACCTTGGATCAGATCATAGAGAGTTCCAGCATTATTTATGAGCATGATGACTCCGAGACCCAGGA
AGACAGTTTTGTGATTAAACTAACAGATGGGAAGCACTCTGTGGAAAAGACGGTCCTCATTATAGTTATC
CCTGTTGATGATGAGACGCCCAGAATGACTATCAATAATGGACTAGAAATAGAAATTGGGGATACCAAGA
TTATCAACAACAAAATATTAATGGCAACAGATTTAGATTCAGAAGACAAATCTTTGGTTTATATTATTCG
TTATGGGCCAGGACATGGCTTATTACAGAGACGAAAACCTACTGGTGCCTTTGAAAATATCACACTGGGC
ATGAATTTTACCCAGGATGAAGTAGACAGAAACTTAATTCAGTATGTCCATTTGGGGCAAGAGGGCATTC
GGGACCTAATTAAATTTGATGTGACTGATGGAATAAATCCCCTCATAGATCGTTACTTTTATGTGTCCAT
CGGGAGCATTGACATTGTCTTCCCTGATGTGATAAGTAAGGGAGTGTCCTTGAAAGAAGGTGGCAAAGTC
ACTCTTACAACAGACCTACTAAGCACTAGTGACTTGAACAGTCCTGATGAAAACTTGGTTTTTACCATCA
CCAGGGCTCCCATGCGAGGTCACCTGGAATGCACGGATCAGCCTGGTGTGTCCATCACGTCTTTCACTCA
GCTGCAACTGGCTGGAAACAAAATCTACTACATCCACACAGCTGATGATGAAGTGAAAATGGACAGTTTT
GAGTTTCAAGTCACCGATGGACGTAACCCTGTCTTTCGGACATTCCGTATCTCCATTAGCGATGTGGACA
ATAAAAAGCCAGTGGTCACCATCCACAAGCTGGTTGTCAGTGAAAGTGAAAACAAGCTGATTACTCCTTT
TGAGCTCACTGTCGAAGACAGAGATACTCCTGACAAGCTCCTGAAATTCACTATCACCCAGGTGCCTATT
CATGGCCATCTCCTATTCAACAATACCAGACCTGTCATGGTTTTTACCAAGCAAGACTTGAATGAAAACT
TAATCAGCTACAAACATGATGGCACTGAGTCAAGTGAAGATAGCTTCTCCTTCACAGTGACTGATGGCAC
CCATACAGACTTCTATGTTTTTCCTGATACGGTGTTTGAAACAAGGAGACCCCAAGTGATGAAGATCCAG
GTCTTGGCTGTTGACAACAGTGTCCCCCAAATCGCAGTGAATAAGGGGGCCTCTACACTTCGCACTCTAG
CCACTGGCCACTTGGGGTTCATGATCACAAGCAAAATATTGAAAGTGGAGGACAGAGACAGCTTACACAT
TTCTCTTAGATTTATCGTGACAGAGGCCCCTCAACATGGATATCTTCTCAACCTGGACAAAGGCAACCAC
AGCATCACTCAGTTCACACAAGCTGACATTGATGACATGAAAATATGCTATGTCTTAAGAGAAGGGGCTA
ATGCCACAAGTGATATGTTCTATTTTGCAGTTGAAGATGGTGGTGGAAACAAGTTAACGTACCAGAATTT
TCGTCTGAATTGGGCATGGATCTCCTTTGAAAAGGAATATTACCTGGTCAATGAGGACTCCAAATTTCTA
GATGTTGTTCTTAAACGTAGAGGTTACTTGGGAGAAACTTCTTTTATAAGTATTGGCACAAGAGACAGAA
CTGCAGAAAAAGACAAAGACTTCAAGGGCAAAGCACAGAAACAAGTGCAGTTCAACCCAGGCCAGACCAG
GGCCACATGGCGAGTGCGGATCCTGAGTGATGGGGAGCATGAGCAGTCTGAAACCTTTCAGGTGGTACTC
TCAGAGCCCGTGCTGGCTGCCTTGGAATTCCCCACAGTCGCCACTGTTGAGATCGTTGATCCAGGAGATG
AGCCAACTGTGTTTATTCCCCAGTCCAAATACTCCGTTGAAGAAGATGTTGGTGAGCTGTTCATTCCCAT
CAGGAGGAGCGGAGATGTGAGCCAGGAGTTGATGGTGGTCTGTTATACCCAACAAGGAACAGCAACTGGA
ACTGTGCCGACTTCCGTGTTGTCTTACTCTGATTACATATCCAGGCCTGAGGACCACACCAGTGTTGTCC
GCTTTGACAAAGATGAACGGGAGAAACTGTGTCGGATAGTCATAATTGATGACTCTTTGTACGAGGAGGA
GGAAACCTTCCATGTCCTTCTGAGCATGCCCATGGGGGGAAGAATCGGATCAGAGTTCCCAGGGGCTCAA
GTTACAATCGTTCCTGACAAAGATGATGAACCCATCTTTTACTTCGGTGATGTGGAATACTCTGTGGATG
AGAGTGCTGGCTATGTGGAAGTGCAGGTGTGGAGAACGGGCACTGACCTGTCCAAGTCTTCTAGTGTCAC
AGTGAGGTCTCGGAAAACAGATCCTCCCTCTGCAGATGCTGGAACAGACTATGTGGGCATCAGCCGTAAT
TTAGATTTTGCACCTGGAGTCAACATGCAGCCTGTTCGTGTTGTCATTCTGGATGACCTTGGACAACCAG
CGCTGGAGGGAATTGAGAAATTTGAACTGGTGCTTCGCATGCCTATGAACGCAGCCCTTGGCGAGCCCAG
CAAAGCCACAGTGTCCATAAATGACTCTGTCTCCGATTTGCCTAAGATGCAATTCAAAGAACGAATATAT
ACTGGCAGCGAAAGTGATGGGCAGATAGTTACAATGATCCATAGGACTGGGGATGTCCAGTACAGATCTT
CAGTGAGATGCTACACCCGGCAGGGGTCTGCACAGGTGATGATGGACTTTGAAGAACGCCCAAACACTGA
TACCTCCATCATCACATTCCTCCCTGGTGAGACAGAAAAGCCCTGCATTCTTGAGCTGATGGACGATGTG
CTCTATGAGGAGGTAGAGGAGCTCCGCCTGGTACTCGGCACTCCACAAAGCAACTCTCCCTTTGGGGCTG
CAGTTGGTGAACAAAATGAAACTCTCATAAGGATCCGAGATGATGCTGATAAGACTGTTATTAAATTTGG
AGAAACCAAATTTAGTGTCACTGAACCCAAAGAACCTGGAGAGTCGGTGGTTATAAGAATTCCAGTGATT
CGCCAAGGAGACACTTCAAAGGTTTCCATTGTGAGAGTCCACACCAAGGATGGCTCGGCCACCTCTGGAG
AAGACTACCACCCTGTGTCAGAAGAAATTGAGTTTAAGGAAGGGGAAACCCAGCACGTGGTTGAAATCGA
AGTTACCTTTGACGGGGTGAGAGAGATGAGAGAGGCCTTCACTGTTCACCTAAAACCTGATGAAAATATG
ATAGCAGAGATGCAGTTGACGAAAGCCATTGTGTACATAGAAGAAATGAGCAGCATGGCAGATGTCACTT
TTCCTTCTGTCCCTCAAATTGTATCCCTGTTGATGTATGACGACACTTCCAAAGCTAAGGAGAGTGCTGA
ACCCATGTCTGGCTATCCTGTCATCTGTATCACAGCTTGCAACCCCAAATATTCAGACTACGATAAAACA
GGCTCTATCTGTGCAAGTGAGAACATCAATGACACTTTGACGCGGTACCGGTGGCTGATTAGTGCACCTG
CGGGCCCTGACGGTGTGACCAGCCCTATGAGAGAAGTGGACTTCGACACCTTTTTTACGTCATCCAAGAT
GGTCACACTGGACTCCATATACTTTCAGCCTGGCTCCCGGGTACAGTGCGCAGCTCGTGCTGTGAACACC
AATGGGGATGAAGGCCTGGAGCTCATGAGCCCTATTGTAACCATCAGCAGAGAAGAAGGTCTTTGTCAGC
CCCGTGTACCTGGGGTTGTTGGAGCAGAGCCGTTCTCAGCTAAATTGCGCTACACAGGCCCTGAGGATGC
AGACTACACAAACCTTATCAAGCTCACTGTCACAATGCCACACATAGATGGCATGCTCCCCGTGATCTCC
ACTAGAGAGCTTTCCAACTTTGAGCTCACCCTCAGCCCTGATGGCACAAGAGTTGGAAACCACAAGTGCT
CCAACCTCCTGGATTATACTGAAGTGAAGACTCATTATGGTTTCTTGACTGATGCTACCAAAAATCCAGA
AATAATTGGAGAGACATATCCTTACCAGTACAGCTTGTCCATCAGAGGTTCCACTACCTTGCGCTTCTAC
CGGAACCTGAACCTAGAGGCCTGTTTATGGGAGTTCGTTAGCTACTATGACATGTCAGAACTCCTTGCTG
ACTGTGGTGGCACCATTGGAACAGATGGACAGGTCCTAAACCTAGTGCAGTCCTATGTGACCCTTCGAGT
CCCTCTGTATGTTTCCTACGTGTTCCATTCCCCCGTGGGGGTAGGAGGCTGGCAGCATTTTGACTTGAAG
TCAGAGCTTCGTCTAACTTTTGTGTACGACACCGCCATCTTGTGGAATGATGGAATTGGCAGCCCCCCAG
AGGCTGAACTTCAAGGTTCTCTCTATCCAACCAGCATGCGCATCGGTGATGAGGGGCGCTTGGCCGTGCA
CTTCAAGACAGAGGCTCAGTTCCATGGCTTATTTGTGCTGTCACATCCCGCATCCTTTACAAGCTCAGTG
ATCATGTCAGCTGATCATCCAGGCCTGACATTTTCCCTCCGCCTCATAAGGAGTGAACCAACCTATAACC
AGCCAGTACAGCAGTGGAGCTTTGTCTCTGACTTTGCCGTACGTGACTACTCAGGGACCTATACTGTGAA
GCTGGTGCCATGCACTGCCCCATCACATCAGGAATACCGCCTGCCAGTCACCTGCAACCCCAGAGAACCT
GTCACCTTTGACCTTGACATCCGATTCCAACAGGTCAGTGATCCAGTGGCTGCTGAGTTTAGCTTGAACA
CCCAAATGTACCTGCTCTCTAAGAAGAGTCTCTGGTTGTCTGATGGATCCATGGGATTCGGGCAAGAGAG
TGATGTTGCTTTTGCAGAAGGTGATATAATTTATGGTCGTGTCATGGTGGATCCTGTCCAGAATCTGGGT
GACTCCTTTTACTGCAGCATTGAGAAGGTGTTTCTATGCACTGGAGCTGATGGCTATGTTCCCAAGTATA
GTCCAATGAATGCAGAATATGGCTGCTTAGCCGACTCTCCTTCACTCTTATATAGATTTAAAATTGTGGA
CAAAGCTCAGCCAGAGACACAAGCGACCAGTTTTGGAAATGTCCTATTTAATGCCAAACTAGCAGTGGAT
GACCCTGAAGCCATTCTCTTAGTGAATCAGCCTGGATCTGATGGATTTAAAGTCGACTCAACACCACTCT
TTCAGGTCGCTCTAGGCCGAGAATGGTATATACATACGATCTATACAGTGAGATCGAAAGACAATGCCAA
TCGAGGTATTGGCAAAAGAAGTGTGGAGTACCATTCTCTGGTGAGTCAAGGAAAGCCCCAATCCACCACC
AAGAGCCGGAAGAAGAGAGAGATCAGGAGCACACCCTCACTGGCATGGGAGATTGGTGCTGAAAACAGTC
GAGGAACAAACATCCAGCACATTGCCCTGGACCGCACCAAGAGGCAGATCCCCCATGGGAGAGCACCTCC
AGATGGCATCCTCCCCTGGGAGCTCAACAGCCCCAGCTCTGCAGTCAGCCTGGTCACTGTGGTGGGAGGC
ACCACGGTAGGGTTACTCACCATCTGCCTCACTGTCATTGCAGTGCTGATGTGCAGGGGCAAGGAAAGTT
TCAGGGGGAAGGATGCCCCGAAAGGCTCCAGCAGCAGTGAGCCCATGGTGCCCCCACAGAGCCATCACAA
TGACAGCTCAGAAGTTTGATGACTGCAGGTAGAATTCAACCTTTTCCGTAAGTGCCTCGGAAAAGATCAC
AATGGAACCTTAAATACTTCTGGTAAACCATAGAGAATGGAGGATGGCTGTGATGAAGCTGCTTAGAGAA
TATGACTGTACTAATGGAGTTTGATTTGAATTCTCCATACTCTTTTTTGCATCAAAGGACAAATTAAGGC
ATCTTTCCTCTTGCCCCAAAGGCAGCAACAACGTACTCATATGTACACAGAGCCATGATGTGAGGAATGT
ACTCCTCATTTTAGACATATTCTCTATGCAGTGGAGATAAATCTATTAAAAGGTGCTAACAGACTCTCTT
ACAAGTGTAAGAGGAATCTACTGTTGCTATGTTAGTGTGAATGTTGAAGGTGCAATTATCACATTGTTTA
TTAATTGTATAACAGATTATTACTAGAAAGGTTTTTGTTGCTAGTCTGGAAAACTGGTGAACACACTGTT
TATTATGACAAGTTTTCAAATAGGTGAAGACAGCATAGAATTATGACCAGGGTGGCTCAACCCACAAATC
AACTGATCTACTACTTGGGAGACAGTGGAAGGAAAGATAGAGGGAAGGAAGTTCACTCACTTGAATTTGA
ATTGCTTCTCATTCTCATCAGACTCTCCTTGTTTTGTTTGCATATTTAATTTTAAATTAAACCAAAGAAT
ATGTTAATTCTGAAAGAGATTTTTAAGAGATGCTGCTCTGTTTTGGCATATAGTGAGTAATGGTAGAGCT
CTTGCATGGTAATATACCTTATTGGTGCTCAACATTTGTGGGAAATTAGAGGGTTGGTGAGATTTTGGTG
ATGAATAAATGCCATAGAGTTAGAGTCACTACAAGACAATGTTCTCTAAGAACTGAGCCTAGATGTTTGC
AGTATTGAACCCATAAATGATAATAAGAAACATTGTTACAGATGGTGAAGGGAGAAAGTGGTATTTATTA
ATATAATGTGTATAATCAGAGTGCCTCTTATACATACTTTATAGAATAAAGGAACATTTTGACAGATGAG
GTTATCCCTCGGAGTAGCGTAATCACACAATAACATTTAGAACTTAAATTGGCTACAGGACATTTTATTA
GCTTTCTATCCAGCATCTGGTCCAAACGATGGGACTCTCTGCAACTATCATTCCAGAAATGGTCTTGGAG
GTGGCCAGAATCATTGACCATATTTTTATTTGGTTCAAGAAGACATCGCTCTGGCATCCCCAGTTCAGTG
AACTGGTACAATGTGGTCCCTCTCAATATTTAAAAATATAATTTGTAACAGTGCTTACCATTCACCTCCC
AAAGCCAAGGAACTTGAGTGAGCTTCCTTGGCAAGCCTCCCATTGCCTTTCTGCATCAATGTGTTTGTTA
CCAAATAGCAGAAATTTCGCTTAGAAGGGGAAAACTTCAGCTTTCCAAAAGCTAGTAAACATGTTTCAAA
GAAAAATAAGGTCAGGAGAAAAAGAATAATGCCTACAGATTATCCTTCAGATGCTGGCTAGAATCCCCTT
TGACTTCTAGCCATAAGCTGGCCACATTGGACATCTTGGTCACTGCAGAATTTTAAAAGGCAAACTTCTC
AGAACAGATGTGCACATCTTAATTTGGTGTCTGTAAGTATCAACCATTTCTTGATCAAGATAAGGAAGCA
ACACTGATACTGAGAGAGAGGTCATATGTCCAATAGTTGCCTTTCTTCTCTTAGGCAGCTCTGCACTTCA
TGTTCAGTTTTTTAAAAATAGACTGTAGTATCCTTTCATTGGAGAATTTACAAAAATATCATCTACAGCT
CAAAAGTCCCACTAACGGCTTATATGAACAGAAAGTACTGTGTAGCCCAGGAGTTTATTTAGCAAGATAA
ATAGTGGTAATTTCTTAATCATTCCCCTTTCCTTTGCTTTACCTTCTGGCAGATGCTTAGCTACTTCTTT
GGCTACCTCATAATTTGTATGGGAATGAACATGAATTAGGGAACTTCAAATAGTGCGTAGACTTTTCCCT
ACTTACCATTGGGTTCAATTGATGTAGACTGTTAGAGCAAGTATACTCAATCAACTTGCTGATATTTTAG
TAGTTAACAGCTTCCGAGCCTATCATGCAATTTGGAGTCTGTCAATGAATATAGCAATCGGTGAAGCATT
ACTGTACGAAGTCTGTTTTCAGGCTTTGGGTCAAGCTGGTTTTATACCAAATTTCACTCTACAATGCATA
TTCTAATGAAGCTACTTTATATAAATTGGAGAGCTTATAAAATGCAGAACATTTCTATCCTATCCTACCA
AATATTTATCCTTCTCTGTCCTCTATTCTCTTACTCTCCTCTCTCCCTTTTTCCTTCCCTTTATTCCCTT
GAAAAAAGAGAATCTGTGGGAAATAGGCAGATATAGCTTTTTAAAATATAAAGTACTTGGGATTTTGCAT
TATTTTTCTTAATATCTATTTACTAAGTATGTAATTTAATATACATTAATTATTTTTTGAAACTCTTGTT
AGTGGGAAGAATATGGTAAATTTTTTGTTAAATAAAATAGACCCTTATGTTTAGCATTTTGTTTTTAGAG
AACTATTCTGGTACTATCAGAACAAATACATAAAATAACTTCCCATAGAGAACAGGATATAGCAATAATA
GCTCCTTAGATACTCAGTGGCTTCTGACTCCAATCAAGGTCTTGTTGATATTATATAGTAAAAATAAAAC
CAAAAATAAATATTATTCAAGTGGCTCTTCTAAGCATGTGAATCATGAAGCACTGAAATATGTATTTTAA
TGATGATCTTATTTATTCCCATTTTTGCCCTTAGTTAACATTTACTGGTGCTCACCTAGGATTGGCTATT
CTGAGGGATTGCATAGAAACCAAGCTCCACTTGCTGTCCTTGGGAAGGTTATAACTGAATGCAGCTCTTT
ATTTGGACTAAAGTGTCAGGATATGCATTAGATTCTCTCCTGAACCAAAAACACAACAGTCATTATCTGT
GAACCATAATTTAAAAATCTTTCTAGAATAACAACAGCAGACTCCACTCTTGTTTGTCTAAAAGAGCCCT
ACTGGGTATGGATCATTCTGATGACAGATTTATACAAAATGATTCAAACCAGTAACTTAGTAAAATTGAC
CTTCGCAAAACCTCACTGGGGGAGTGCCTTGTAGAGCTGTGGGTGGGACTGCACATTCTTTTCCTCTTAG
TAAAAGATAGGCCCACTTTATTCCAAGAATAACACTTAGCACATAAACTCTTCTTCCAGCTCGTTAGCAG
CATTAGCACCTTCTGAATTCCACCCTCTCAGAAGAATCCACAGTGTTTGAACAATTTGCATAAAGGTCAG
CTAGCATCCTGCTGCCAAGCCACTGCATAGCATTTGTGATAAGAAGGACCAACTCTAGGCTCAATATGAA
GGGATTTAGTTCTGTAAGCAGCAAAAAAGCTTCTTTATCAAGTCATCTTACCTCTAATTCTTTTCCAGTG
TGCCAACTCCAAAGTCAACATTAAAAATGTAAATGGACCTGTGTAAATATCACAGAGAGCTTTTCCTTAT
ACATCTCAATGCTGAGAGTTAAAATATTCCCAGGTTAAAATTTTTTTAAAGTACCAATAATAGAGCTAAA
TACAATGACATTTGCTTTTAAAAGGTGGATATTTTATTTCTGCTTTTTGAAAATACTTATTTAGTATTGA
CTTGGAAGCCAATTTGGTCCTTTAATAAGTAAAGAAAATAATATGTTTAAAAATGTAAATGTTTTACAAA
TTTGAAACTTTCATAATTGTATTAATCAGAAAACAAGCACATTGCCATTCTTTGAAACTCATGTTTCTAG
ACATGACAGCAGTAATAAAAGGATGAAAACAAGTGTCTTCACTAAGCGTATGGCCAATAAATGGGACCCA
AACGTTCAATCTGTTCAGTTTACCAAGGTTCAGAAATACGTAATTTAGCAGGAAACTATAAATACCAGTG
CTATCACAGCCACACATACACACACACAGACATAAAATAACCAAACATCTCATTTCTAGGAAAGAGATAA
CACTAAAGGCATCATAGGTTTAACTGAAATACGTTATATGAAGTTTTACAAAAAGGTCAACAGAAAGCTC
ATTTGTGAAAACATACTCTCATGGGAGCTTCTTTAACATTAGTTCAGAGGTTAATATATTTCCTGGAGGT
GTTTTCCTAGAATTGATTGCACTATTGCATGGTAATAACATTTAATTGTTAAGGAAACATTATATATAGG
TTCAAATTATCCCTTAATGTTGATTTCTCCCCTTTTCCATGGATTTTGATACTAAGAAACAAAATGCTTT
GAGATTTTGGTAACTATTTTGATTTTGATAAAACATGTTAAAATAGAAGGACATGATATTTTTCTATAGT
TTCCATCAGGAAGAGTACATCAGAAACTTCTCCATAAGGAAAGAAAACTGACTCTCTCTTGAACTAGTGT
TGACAAAATACACTAATGTCTTTCTTAATTTTATTTTATTAGGAGAAAAATCAGAATATTAAATTTGCAA
ACTTTTGAACAGCAGTAATAGCTCCTTAGACACTCAGTATCTTTCTTCCCTATCTTTCAAGCACATTTAA
TTTCTTTCCCCTGGTATTTGTTTGCTTTGTGTTTTTTCAATATTTTGTTTGCTAAAGAACAATAACAACA
ACAAAGCTGGTCCAGCCCTGACACCTACTTTTGCTTTTTTTCTTTCTTTCTTTTAATTTGTTGAACTATA
GGTTTCTTTCTGAGATGTATTTTTCATTCTTCCAATAATGCTCTCTTTTTCATTTCAAAACCATTACCAC
TTTCAATATGTAATTAACATCCTCATTCATCAGAAAGCTGGTAAGTCCACACAGCATTTGTGCAGTATCC
CTTCTGTGTAAAATGTTAAGGCTTTCAGATGAAAGAAAAAAGAACTTCCTGCAAAAGATCAAAAGCATCA
TACTAAATAAAATGATGACAATATGTGCCTTGATTTTTCTCTCAATGGAGGTTCAACATTGACATTTAAG
ATGTAAAAAAAATTACTTTGATGGTTTAATTAAGAATAATAAGTCAAATATCACATGTATGTAGTTCTTT
TGGATGACCGAATACCTTAAAATGAACTAAATAACTGAAATAAAGTGTTAAAATGTTAACAGCGTTGAAG
TTTTTAAAATTATAATTATCAAATGCACAATGTTCTTTTACTATGCCAAATGTTGCCTACACTGATTACA
TGATTGTCACAGTTTAAGTGAATTTCTACTATGGATCTTTATTTTCCCCAATGTTTGGATCATCCTCTCA
GATAAGAATTGTCAGTATTGCACCTCAAGAAAGAAGAAAAAATAAGAATGTAAATTTTTAAAAGCTAGCA
TTAAAAGTAAAGAGCAGTACAATAAAAATCACTTAAAATAGAGAAAGGCAACTACTGAGTAAGAAGAAAA
GATAATTTCTGTAAAAGCTAAATTTATGCACATTACAAAAAGTAGTCAAGTCAGTCTTCCATTGTGACTT
CAGGAATTCAAATGCAAGTTGTTGGCAAAATATATATATACACACACACACACATACACACACATATATG
TACATACATATATATATAGAGAGAGAGAGATAGATTTTTTTTTTTTGAGACAGAGTTTCGCTCTTGTTGC
CCAGGCTGGAGTGCAATGGAATGATCTTGGCTCACCGCAACCTCCGCCTCCAGGGTTCAAGTGATTCTCC
TGCCTCAACCTCCTGAGTAGCTGGAATTACAGGTGCCCACTACCATGCCTGGCTAGTTTTTGTATTTTTA
GTAGAGACAGGGTTTCTCCATGTTGGTCAGGCTGATCTCGAACTCCCAACCTCAGATGATCCTCCCGCCT
CCACCTCCCAAAGTACTGGAATTACAATGGCGTGAGCCACCACAAGATATTTTTAAAGCCCATTTGTCTA
TAAAAGAAAACTCTTGGACAAGGAGCTTTGTGTTTTATAATTGTATTACGTGCCTGCTTCCTTACCAAGT
GCCCTCCATAACACTAAGTAAATTTATATTTATCTAGCCTCTGAGTGACATATCTGTGTGTAATGGAATT
ATTTGCAGAATTTAATAGCCTTTTTTATTTTCGCATGAGAATTTTTCAAAAACTATCAGGGTCTAGTTTT
ATCATACATTTACTAAGTTACTACATATTGGTGGATATTGACGTTTATTCCTGGGAATCTAATTTTGCAA
ACAATTTGGAGCCATTCAGTCATAAATTCATGTCAACAATAAGTCTTGCTGCCGCTTGTGTTTCATAACT
ACGCTTGCTTTCCTTCAAAATATACCAAGTGTGTAATATAAATAAAGCCCATATCAATATAAAAAAAAAA
AAAAAAAAA

Композиционный код 6:

5,3,5,5,3,5,5,3,4,4,1,1,3,2,3,5,5,2,5,3,3,5,5,3,5,5,3,5,5,2,3,2,5,3,5,5,3,5,3,3,4,4,4,1,1,1,2,5,5,5,
2,3,5,2,1,1,1,1,1,1,1,1,1,1,1,4,4,2,5,5,2,3,3,5,3,4,4,4,3,5,5,5,3,5,5,2,5,3,5,3,3,1,1,4,1,3,2,1,4,1,
1,4,1,6,1,2,5,5,3,5,5,3,1,4,1,4,2,1,1,1,1,1,3,3,2,2,5,2,4,4,1,4,4,4,4,4,4,4,3,5,5,2,5,2,1,1,1,4,2,5,
5,3,1,1,1,1,4,1,4,1,3,3,4,4,4,3,2,5,5,3,3,5,5,5,2,4,4,4,1,1,2,4,4,4,3,5,5,3,3,4,4,4,3,5,5,3,1,4,4,1,
1,4,1,1,4,1,1,1,4,3,5,2,2,5,5,5,2,5,5,5,2,4,1,1,4,3,1,1,1,1,4,1,1,3,5,3,1,1,4,1,1,3,1,4,1,4,1,1,4,3,
4,1,1,1,4,4,1,4,1,3,5,5,5,2,5,2,2,5,2,2,5,2,4,1,4,1,4,1,1,1,1,4,1,3,5,3,5,5,5,3,4,4,4,3,1,4,4,4,1,1,
3,1,4,1,4,4,1,4,1,1,1,1,1,1,1,2,1,1,1,1,4,1,1,4,1,1,1,1,4,4,3,5,3,2,3,1,1,1,1,4,1,1,3,2,2,5,3,5,2,1,
1,4,1,3,1,4,6,1,1,3,3,5,5,3,2,5,5,5,3,5,5,2,5,5,3,5,2,2,1,1,1,1,2,1,6,4,4,1,4,3,2,2,5,3,3,5,5,5,3,3,
5,3,1,1,1,1,1,3,4,4,1,1,2,2,4,1,1,1,3,2,5,5,5,3,1,4,1,6,6,6,6,1,4,1,1,3,2,4,4,1,4,1,2,4,4,4,2,5,5,3,
3,5,3,5,3,1,4,1,1,1,1,3,3,3,2,5,5,3,1,1,1,1,1,4,1,1,3,3,1,1,4,1,3,5,5,5,3,5,5,3,4,4,1,4,1,3,1,1,1,1,
3,3,3,5,3,1,1,1,1,1,3,3,5,3,5,5,2,5,3,2,3,2,2,3,2,5,3,3,5,5,5,2,4,4,1,1,6,1,2,5,3,4,4,1,1,4,3,5,3,3,
3,5,3,5,3,5,3,5,5,5,2,5,3,2,5,3,3,5,3,1,1,1,1,1,3,5,3,5,2,3,2,5,5,2,4,4,4,3,4,4,4,3,3,5,3,5,3,5,3,3,
5,3,5,5,3,3,5,5,5,3,2,5,3,5,5,2,1,1,1,4,1,1,1,3,3,5,3,1,1,4,4,1,1,1,4,4,3,4,4,4,3,2,2,1,1,1,1,2,5,3,
4,1,1,1,1,3,5,3,5,3,5,5,2,3,3,5,3,1,1,4,4,4,2,5,2,5,3,3,2,4,1,1,4,1,3,5,5,3,2,3,5,5,3,2,3,3,3,5,5,3,
3,5,5,5,2,5,5,3,3,5,5,3,5,3,5,5,3,3,5,3,5,3,5,5,5,3,3,5,3,5,3,1,1,1,1,4,2,3,3,5,2,2,5,2,1,1,1,1,1,1,
2,2,1,1,1,4,1,3,3,5,3,5,5,3,3,3,5,2,5,2,5,5,5,2,3,3,5,5,3,5,3,5,3,3,3,4,4,4,2,5,5,3,5,3,3,5,3,3,5,3,
5,5,3,4,1,4,1,3,5,3,5,3,3,5,5,2,5,3,5,5,5,2,2,4,1,1,1,1,4,1,1,3,5,5,5,2,3,5,2,3,2,3,5,2,5,3,5,5,5,2,
5,2,5,3,3,5,5,2,5,2,5,3,1,1,1,1,3,5,5,5,2,1,4,4,1,3,3,5,3,1,1,1,1,3,3,3,3,3,5,3,5,5,3,3,3,4,4,4,3,3,
2,4,1,1,1,1,1,1,4,3,5,2,3,5,3,5,3,2,3,5,3,5,3,5,5,3,1,4,1,1,1,2,3,1,1,1,1,1,1,1,3,3,5,5,5,3,1,1,1,4,
3,5,2,1,1,1,4,3,3,2,5,3,3,3,5,3,5,3,5,3,5,3,5,2,5,3,3,5,5,5,3,5,3,2,4,4,4,3,2,5,3,1,1,1,1,1,1,2,3,5,
5,2,3,5,3,5,3,3,4,1,1,1,4,3,3,1,1,1,1,3,5,3,5,3,3,3,4,4,1,1,3,5,3,2,3,5,5,2,5,3,3,3,5,5,2,5,5,3,3,3,
5,3,5,5,5,3,2,3,5,3,3,3,5,3,3,3,5,3,5,3,3,3,5,5,5,3,5,3,3,3,1,1,6,1,3,5,5,5,3,3,2,3,5,3,5,3,5,5,5,3,
5,3,2,2,5,5,3,3,3,1,1,1,1,1,1,3,3,2,3,5,5,5,3,3,5,2,5,2,5,3,3,5,3,3,3,5,5,3,5,2,3,5,3,3,3,5,3,3,3,5,
3,3,5,3,2,3,3,2,1,4,1,1,4,3,3,3,5,5,5,2,3,5,3,2,3,3,5,5,2,2,5,3,3,3,3,3,3,2,2,2,5,3,2,3,3,3,3,1,1,1,
4,3,3,1,1,1,1,3,2,3,3,5,3,3,2,3,3,3,3,5,3,3,2,2,2,5,3,5,3,2,3,2,5,3,5,2,3,3,5,5,5,3,3,1,1,1,1,1,2,5,
3,5,5,3,5,3,3,5,5,3,3,5,5,5,2,3,2,3,3,3,3,3,5,3,5,3,2,5,3,1,1,1,1,3,2,5,3,5,5,3,3,3,5,2,5,5,3,5,3,3,
3,5,5,5,3,5,5,3,5,2,3,3,2,5,3,5,3,3,3,3,3,3,3,5,5,3,3,3,3,5,3,3,5,3,5,5,3,3,3,5,5,5,3,5,5,2,3,5,5,3,
5,5,3,1,1,1,1,3,5,5,2,5,3,5,5,3,3,3,5,3,3,1,1,1,1,1,3,5,3,3,5,3,3,2,2,3,5,5,5,3,5,3,1,4,1,1,3,2,3,5,
3,3,3,3,5,5,5,3,5,3,5,3,3,2,2,3,2,3,3,5,3,5,5,3,5,5,5,3,2,3,5,2,2,3,3,3,2,3,5,3,3,5,3,3,3,3,3,3,5,2,
2,3,5,3,3,5,3,2,3,3,3,3,5,3,3,3,5,2,5,5,5,3,3,5,5,3,3,2,5,3,5,3,3,5,3,5,3,5,5,3,5,5,3,5,5,2,3,3,3,3,
5,3,3,2,2,3,5,5,2,3,3,5,3,3,4,1,1,4,1,3,5,3,5,5,3,3,5,2,3,5,2,5,5,5,3,3,3,5,3,5,3,3,2,2,5,2,2,5,3,3,
5,5,5,3,3,3,3,5,5,3,3,1,1,1,1,3,5,5,2,3,5,5,3,5,5,3,5,3,3,4,1,1,4,3,5,3,5,5,3,5,3,2,5,3,1,1,1,1,1,2,
3,3,3,3,5,3,5,5,3,3,5,3,3,5,5,3,2,3,5,3,5,3,5,2,5,3,5,5,3,5,3,5,5,3,3,5,2,4,1,1,1,1,1,4,3,5,3,3,3,3,
4,4,4,3,3,3,3,5,5,3,5,3,5,3,3,3,3,1,1,1,4,3,5,3,1,1,1,4,3,3,3,5,3,5,2,5,5,3,5,3,3,5,5,3,3,5,5,3,5,5,
3,3,5,3,5,5,5,3,3,3,5,3,5,2,3,3,3,1,1,1,1,2,5,3,3,5,5,3,2,5,5,3,3,3,3,3,5,5,3,3,2,5,3,5,3,4,6,1,1,1,
1,1,3,3,5,5,3,5,5,3,5,2,5,3,5,5,5,3,2,3,5,3,2,5,3,1,1,1,4,1,6,1,2,5,3,2,5,3,5,5,5,3,5,5,3,5,3,3,3,3,
3,5,5,2,5,5,3,3,3,2,3,3,1,1,4,1,3,1,1,1,1,1,3,5,5,2,3,3,5,3,3,5,5,3,2,5,3,5,3,3,3,5,3,3,5,2,3,3,5,5,
3,3,2,3,3,3,3,3,2,5,5,3,5,5,5,3,3,3,5,3,5,2,5,5,5,3,3,5,3,3,5,5,5,3,5,5,5,3,3,2,3,3,3,3,3,3,3,3,5,5,
2,3,3,3,3,2,3,3,5,2,3,5,3,3,2,3,3,5,3,1,1,1,1,3,2,5,3,3,4,1,1,1,2,1,1,1,1,1,2,5,2,4,4,1,4,3,3,5,5,3,
5,5,3,3,5,3,5,5,2,5,2,1,1,4,4,3,5,5,3,5,5,2,5,5,3,3,5,5,3,3,2,2,3,5,2,3,5,3,3,5,5,5,3,5,5,3,3,3,3,3,
3,5,5,5,3,1,1,1,1,1,2,3,4,1,1,1,1,6,4,1,3,3,5,3,3,2,2,2,3,2,3,5,5,3,5,5,5,3,5,3,3,5,2,5,5,3,1,1,1,1,
3,3,5,5,3,5,3,3,3,5,5,3,5,3,5,2,5,2,3,3,5,3,1,1,1,1,1,3,5,5,3,5,3,4,1,6,1,6,4,2,3,5,2,2,5,5,2,5,3,3,
3,2,5,3,3,5,3,3,3,3,5,5,3,5,5,3,3,5,3,5,3,5,3,5,3,3,5,3,5,3,4,1,4,1,3,5,5,3,1,4,1,1,3,3,3,5,2,5,5,3,
5,3,2,3,3,5,3,2,3,3,2,2,5,3,4,1,1,1,3,3,3,3,3,2,3,2,1,1,6,1,3,3,3,3,5,3,5,3,5,3,2,3,2,5,5,5,2,3,5,3,
3,3,5,5,3,5,5,3,5,5,2,5,3,1,1,1,1,3,5,2,5,5,2,3,5,3,5,5,3,5,3,5,5,3,5,3,3,2,2,3,3,5,5,3,3,3,5,5,2,3,
2,5,5,3,5,3,5,3,5,5,5,3,3,2,5,3,1,1,1,4,1,4,3,2,1,4,6,6,1,3,3,3,5,2,5,3,3,1,1,1,1,2,5,5,3,3,5,2,3,5,
5,5,3,3,1,4,6,1,3,5,5,3,5,5,2,1,1,1,1,4,2,5,5,3,2,3,5,5,3,5,3,5,3,2,3,3,3,3,3,3,3,5,2,5,5,2,3,3,3,3,
5,3,3,3,3,3,2,3,5,3,3,3,5,3,3,5,3,3,3,2,4,4,4,3,2,3,3,2,5,3,5,3,2,5,3,2,5,3,5,3,5,3,1,1,1,1,3,1,4,1,
1,3,2,3,5,5,5,3,5,2,3,3,3,5,3,5,3,5,3,1,1,1,4,3,3,5,3,3,5,3,4,4,4,3,5,5,3,5,5,5,3,3,5,2,3,3,3,3,3,5,
2,2,1,6,1,1,4,3,5,3,5,5,2,3,3,6,1,1,6,2,3,5,3,3,3,3,5,3,3,3,2,1,4,1,6,3,5,5,3,5,3,3,5,5,3,3,3,5,5,3,
5,3,3,5,5,3,5,2,3,5,5,5,3,3,2,5,5,3,3,2,5,3,5,3,2,3,5,5,5,3,5,3,1,4,4,1,4,1,4,3,3,2,3,5,5,3,5,3,5,5,
5,3,5,3,3,4,1,1,1,1,3,3,5,2,1,1,6,1,2,5,5,5,2,5,3,5,3,4,4,4,2,5,5,2,3,3,3,5,5,5,3,5,3,3,1,4,1,1,6,1,
3,3,2,5,5,5,3,3,3,3,3,3,5,5,3,2,3,5,3,3,2,2,5,5,5,2,3,3,5,5,5,2,5,3,5,3,2,5,5,2,5,3,5,5,5,3,5,2,5,2,
5,2,3,1,6,1,1,4,1,1,3,3,5,3,5,5,3,1,1,1,1,1,3,3,5,2,3,3,2,1,1,1,1,1,1,1,4,3,3,3,3,5,5,3,3,3,3,5,5,3,
3,3,5,3,3,2,3,2,3,2,5,2,3,3,1,1,1,1,1,1,1,3,3,5,3,1,1,1,1,1,4,1,4,1,2,5,5,3,3,5,5,5,3,5,5,3,5,5,2,3,
5,3,3,5,3,3,5,5,3,2,2,3,2,5,5,2,5,2,5,5,5,3,5,5,3,2,5,3,5,3,3,1,1,4,1,3,1,1,4,4,2,2,5,5,5,3,3,5,5,5,
2,5,3,3,2,3,3,4,1,1,1,1,1,1,1,3,3,2,3,5,5,5,2,5,3,3,3,3,3,3,5,3,2,1,1,6,1,1,3,3,1,4,1,1,1,4,1,1,1,2,
5,3,5,5,3,5,3,3,5,5,2,3,5,2,5,3,2,5,2,5,5,5,2,3,3,3,2,5,5,2,3,1,1,1,1,2,5,3,3,2,5,3,5,5,2,2,1,1,1,1,
3,5,3,5,3,5,2,3,5,5,2,5,5,3,3,4,1,4,4,2,5,3,5,2,2,3,5,3,4,4,4,2,1,1,1,1,1,3,3,3,5,5,3,5,3,5,5,2,5,3,
5,5,3,3,2,5,3,3,5,3,1,1,1,1,3,6,1,4,1,3,5,5,3,5,5,5,3,3,2,5,5,2,5,5,3,5,3,3,3,3,3,2,3,3,3,2,3,3,3,3,
4,4,4,3,3,5,5,3,5,3,5,5,3,5,5,5,3,4,4,4,3,2,5,3,2,3,3,5,3,3,5,5,3,3,2,5,3,2,3,3,5,5,3,5,5,3,3,2,5,3,
3,3,3,3,3,5,5,3,3,5,2,5,2,3,5,5,3,3,2,3,5,2,3,3,5,3,2,2,5,3,5,3,3,5,3,5,3,5,3,5,3,2,3,3,2,3,3,5,5,2,
2,2,5,3,5,5,3,2,5,2,3,5,3,2,3,5,5,3,2,5,3,5,3,5,3,5,3,2,3,3,5,3,3,3,5,5,5,3,3,5,5,3,3,2,5,5,3,1,1,1,
1,1,4,1,1,3,1,1,1,1,2,5,2,5,2,5,5,3,3,3,3,5,3,2,2,2,1,1,1,1,3,1,4,1,1,1,1,1,1,1,1,3,5,3,2,3,2,3,1,1,
1,1,1,1,1,1,1,1,1,3,2,1,1,4,1,3,5,5,2,4,4,4,2,5,3,1,1,1,1,1,3,5,3,2,4,4,6,1,1,1,1,3,3,1,1,4,1,3,5,5,
3,1,1,1,1,3,1,1,6,4,1,2,5,5,3,5,3,5,5,2,3,3,1,1,4,1,2,3,5,5,3,5,3,5,5,5,2,3,3,5,3,2,5,3,3,3,3,3,3,2,
5,3,5,5,3,5,3,3,3,3,3,5,3,2,1,4,1,1,1,3,5,3,5,3,5,3,3,3,3,5,5,3,2,3,3,5,2,3,1,1,1,1,3,5,5,3,3,3,3,3,
5,5,2,5,2,5,3,5,3,3,3,3,3,3,3,3,3,5,3,2,5,5,2,3,2,3,3,3,3,5,3,5,3,5,5,3,5,5,3,2,5,5,2,3,5,3,3,3,5,5,
5,3,3,5,3,3,3,5,5,3,5,3,3,3,2,3,5,3,5,5,2,5,5,3,3,3,3,5,3,3,3,3,5,5,3,2,3,5,5,3,5,3,3,3,6,1,1,4,3,3,
5,2,3,3,4,1,1,1,1,2,5,3,2,5,3,3,3,5,5,3,3,5,2,3,3,3,3,5,3,5,3,5,5,3,5,5,5,3,3,5,3,3,5,3,5,3,3,2,5,3,
5,3,3,5,3,5,3,3,5,3,5,5,3,3,5,2,3,3,1,1,1,1,1,3,5,5,2,2,5,3,3,3,3,3,3,5,5,3,3,3,4,4,4,3,3,5,5,5,2,3,
5,2,5,3,5,2,2,3,5,3,3,5,5,3,5,5,2,3,3,5,3,3,3,5,2,3,3,3,5,3,3,3,5,3,1,1,1,1,3,5,2,3,3,3,2,5,3,2,5,3,
5,3,3,2,3,3,3,5,3,3,2,2,3,1,1,6,1,3,5,5,2,2,5,5,2,5,3,5,3,5,5,3,3,5,2,5,5,3,3,3,3,5,3,2,2,3,3,2,5,3,
5,3,5,5,5,3,3,5,3,3,3,3,2,3,5,5,3,3,5,2,3,3,3,5,3,3,3,5,5,3,5,2,5,2,3,5,5,3,3,2,6,1,1,1,2,2,3,3,3,2,
3,3,5,3,3,5,3,2,3,5,3,5,5,3,3,5,5,3,5,5,2,5,5,2,5,3,5,5,5,3,5,3,3,5,3,5,5,3,3,5,3,3,5,3,5,5,5,3,2,3,
3,3,3,3,3,2,5,3,3,5,5,5,3,3,3,2,5,3,2,3,3,3,2,3,3,5,5,3,5,3,5,3,2,5,2,5,5,2,3,5,2,3,5,2,5,5,3,3,3,5,
3,3,3,5,5,3,3,2,3,3,3,5,5,3,2,3,5,5,3,1,1,1,1,2,5,5,3,1,1,1,1,1,3,3,3,5,5,3,3,5,3,3,3,3,1,1,1,1,3,2,
3,2,3,3,5,3,5,3,2,2,5,3,3,5,3,3,5,3,3,1,1,1,1,2,3,5,2,2,5,3,3,5,5,3,5,5,3,2,5,5,5,3,3,5,3,3,3,5,5,5,
3,3,3,3,5,3,5,3,5,3,1,1,1,1,6,3,5,5,5,3,5,5,5,2,3,3,5,2,5,5,5,3,5,2,3,2,3,3,5,5,3,3,5,5,3,2,5,3,2,3,
3,2,5,3,5,5,5,3,3,3,2,3,5,5,3,3,3,3,5,5,3,5,5,2,2,5,3,5,5,3,5,3,3,3,5,3,5,5,5,3,3,2,2,3,5,3,2,5,3,5,
2,5,5,3,3,5,3,3,5,3,2,5,3,3,2,5,5,2,3,3,2,3,5,3,3,3,3,5,5,5,3,3,5,2,5,5,3,2,3,5,3,5,3,3,2,5,3,5,3,3,
5,5,3,3,3,5,3,3,5,3,3,3,3,3,3,5,2,3,5,5,2,5,3,3,3,2,5,3,3,5,3,3,2,3,3,5,3,2,3,3,5,5,2,3,3,3,2,5,3,3,
3,3,5,3,5,5,3,5,2,3,2,5,5,3,3,3,5,2,3,5,5,3,5,3,5,3,5,3,3,5,5,3,3,3,3,5,3,2,3,2,5,3,5,5,2,5,3,2,2,3,
5,3,3,5,5,3,3,3,5,5,3,5,3,2,1,1,1,1,1,2,3,3,3,3,3,3,5,3,3,3,3,3,2,3,5,3,3,5,3,5,3,3,3,2,5,3,3,2,3,5,
5,5,3,3,3,5,2,3,5,5,3,3,5,3,5,5,5,2,3,5,3,5,3,3,5,2,5,3,3,5,3,3,2,3,3,5,3,5,5,3,2,3,3,5,5,3,3,3,2,2,
5,3,5,3,5,3,5,3,1,1,1,1,3,5,2,2,5,3,5,3,3,2,5,3,3,3,3,3,3,2,2,2,2,5,5,3,3,3,3,2,3,1,1,1,1,2,5,5,3,5,
5,2,3,3,5,3,5,3,3,5,3,5,3,2,3,5,5,5,2,3,3,4,4,4,3,1,1,1,1,3,4,1,1,1,2,5,3,5,3,5,5,5,2,5,2,3,3,5,5,3,
5,3,5,5,2,5,3,3,4,4,4,3,2,2,3,2,3,3,3,5,5,3,5,3,3,5,5,3,3,5,2,3,5,2,1,1,1,1,3,3,3,5,5,2,5,3,5,3,3,3,
5,5,5,3,5,5,3,3,3,3,5,3,5,5,3,5,5,3,3,5,5,3,5,5,2,3,1,1,1,1,3,5,3,5,2,3,2,5,2,2,3,3,6,1,6,1,4,3,3,3,
5,3,5,3,5,3,2,3,5,3,3,5,3,5,3,3,5,5,3,3,3,3,5,3,5,3,3,3,3,3,5,3,5,3,5,3,4,4,4,3,3,3,3,5,3,3,3,3,3,3,
3,2,5,3,5,5,2,3,5,5,3,3,5,5,3,3,5,3,3,5,3,3,3,3,3,2,3,5,3,3,2,5,5,3,5,2,3,5,5,5,3,5,3,3,5,5,2,3,5,5,
2,1,1,1,1,1,1,3,3,5,5,3,3,4,4,4,3,5,3,5,5,2,5,3,3,2,5,3,2,3,5,3,3,2,3,2,3,3,3,2,2,5,3,3,5,5,5,3,5,5,
5,2,5,2,5,2,5,2,3,5,2,5,5,2,3,2,2,5,3,1,1,1,1,3,3,5,3,5,5,3,5,3,3,3,3,3,3,3,3,3,5,3,3,3,5,5,3,3,3,5,
5,2,3,3,3,2,3,3,5,5,3,2,3,1,4,1,4,3,5,5,3,5,5,5,3,5,5,2,2,2,3,3,3,5,2,5,3,2,3,5,5,3,3,5,3,3,3,3,5,5,
3,3,2,5,3,5,2,2,3,5,3,5,3,5,3,3,3,5,3,3,3,3,3,3,2,3,5,3,3,5,2,5,3,3,3,2,3,1,1,1,1,3,2,2,3,3,3,2,5,2,
5,3,3,5,3,1,1,1,1,3,5,3,3,2,2,5,3,5,3,3,3,3,3,5,5,3,3,5,3,3,3,3,2,5,3,5,2,2,2,2,3,3,5,2,5,3,5,3,3,5,
3,3,2,5,2,3,3,5,3,5,5,2,3,3,5,3,5,3,3,3,3,3,3,5,5,3,2,2,2,2,2,1,4,1,1,1,1,1,2,3,5,3,3,5,3,3,3,3,3,5,
5,5,3,5,3,3,3,5,5,3,3,2,5,5,3,5,5,3,3,3,3,5,3,5,3,5,3,5,3,5,5,3,2,5,2,5,5,3,5,5,2,3,2,5,5,3,3,2,2,5,
3,5,3,3,5,3,5,3,2,3,3,3,3,1,1,1,4,3,5,5,3,5,5,2,2,3,3,5,5,2,2,3,5,5,3,3,5,2,5,5,3,3,3,5,3,3,3,3,3,3,
3,5,3,3,3,3,3,5,3,3,5,2,3,5,2,3,5,5,5,3,5,5,5,3,5,3,3,5,5,5,2,3,3,2,5,3,5,3,3,5,5,3,3,3,3,3,3,2,3,5,
3,5,2,5,5,3,5,3,5,3,3,5,2,5,5,3,3,3,3,5,3,3,3,3,3,2,2,5,5,3,3,5,5,3,3,1,1,1,1,2,3,5,3,3,5,3,5,5,2,3,
5,5,3,3,5,3,3,3,3,3,3,3,5,3,3,3,3,5,5,5,3,3,3,5,3,3,5,3,5,2,3,3,5,5,3,3,5,2,3,3,2,3,3,3,3,5,5,3,2,3,
3,3,3,5,3,3,2,5,5,3,5,3,5,3,1,1,1,1,2,3,3,2,3,2,5,2,5,2,5,2,5,2,3,2,3,2,3,2,3,3,5,3,5,2,3,3,3,3,5,3,
5,3,5,3,3,3,5,5,3,2,5,3,5,3,3,3,5,2,5,3,3,5,3,2,4,1,1,1,1,1,1,1,1,1,4,3,5,5,3,5,5,5,2,2,2,5,5,3,3,3,
3,3,3,3,3,5,5,3,3,2,3,5,2,5,5,3,2,3,5,5,5,3,1,1,1,1,1,1,1,2,5,5,5,3,5,3,1,4,1,1,1,1,2,3,3,5,5,3,3,2,
5,5,3,3,3,2,3,2,3,5,3,3,2,3,2,3,3,5,5,5,3,5,5,5,3,2,5,5,5,2,3,3,3,3,3,1,1,1,4,2,3,5,3,2,5,3,3,3,2,3,
3,3,5,3,3,3,3,5,5,3,3,3,3,3,2,2,5,3,3,3,5,2,3,3,2,3,5,5,2,5,5,3,3,5,3,3,5,5,3,3,3,3,2,5,3,5,5,2,5,3,
3,3,5,5,2,2,2,3,3,3,5,3,3,3,2,5,2,5,5,3,5,5,3,2,5,3,5,3,3,2,3,3,5,3,5,3,2,3,3,3,3,3,

Вторичная структура (Пикотех-2017) весит около 6 мегабайт в стандарте PNG. На яндекс-фотки не грузится. Но самый интересный фрагмент удалось вырезать в программе Paint:

Изображение

Сиреневым цветом отмечен виток необычной метиониновой спирали. В отличие от альф-спирали у неё более длинный шаг. Метиониновая спираль отличается от обычной альфа-спирали примерно как резьба с более крупным шагом от резьбы с менее крупным шагом:

Изображение

Шаг метиониновой спирали примерно на 25% крупнее шага обычной альфа-спирали. При этом на один виток приходится тоже 3.6...3.7 аминокислотных остатка Met.
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#14 Мукай Кусуй » 17.01.2017, 20:13

Опять Хороший сказочки
Мукай Кусуй
Аватара
Репутация: 57 (+57/−0)
Лояльность: -2
Сообщения: 86
Темы: 4
Зарегистрирован: 24.11.2016
С нами: 1 месяц 27 дней

#15 МАУС » 17.01.2017, 22:45

Игорь Цветков писал(а):Шмулик сегодня на своей помойке зарегистрировал старого лоха-инвестора Сороку и сделал зачем-то скриншот:
....:
Поведайте пожалуйста, что за Сорока такая, что за чудо-инвестор верящей в лженаучный бред Кушелева?
МАУС
Аватара
Откуда: СССР
Репутация: 46 (+46/−0)
Лояльность: 55
Сообщения: 344
Темы: 9
Зарегистрирован: 30.05.2016
С нами: 7 месяцев 23 дня

#16 Kushelev » 17.01.2017, 23:19

Формы, механизмы, энергия наномира. Сообщение 84 575

Пикотехнология белков, ДНК, РНК - 2

Открыт новый тип белковой структуры!

Изображение
Ещё один интересный участок этого белка 3916...4164. Он содержит все типы композиционных кодов: 1,2,3,4, но ... не содержит ни одного витка спирали! Интересно оценить вероятность случайной комбинации композиционных кодов такого типа. Напомню, что спираль возникает при трёхкратном (или более) повторении кодов 1, 4 или их комбинации. При этом третий код должен быть "4", либо спиральных кодов (1,4), идущих подряд, должно быть больше 3.

Изображение
Белковая молекула кончается витком полилизиновой пи-спирали, похожей на винт Архимеда.

Добавлено спустя 1 минуту 37 секунд:
Вторичная структура этого белка (получена с помощью программы Пикотех-2017) весит около 6 мегабайт в стандарте PNG: https://cloud.mail.ru/public/KKjH/goMgmMGAn
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#17 МАУС » 17.01.2017, 23:28

Кушелев прекратите засерать форум лженаучным спамом, по правилам форум ГВ вам давно положен БАН!

Добавлено спустя 10 минут 54 секунды:
ОПЯТЬ ЛЖЕНАУЧНЫЙ СПАМ! АДМИНЫ ЗАБАНЬТЕ КУШЕЛЕВА!
МАУС
Аватара
Откуда: СССР
Репутация: 46 (+46/−0)
Лояльность: 55
Сообщения: 344
Темы: 9
Зарегистрирован: 30.05.2016
С нами: 7 месяцев 23 дня

#18 Kushelev » 18.01.2017, 20:32

Новости рубиновой / микроволновой энергетики и транспорта

Кушелев: Сегодня состоялась встреча на оборонном предприятии. Работы по включению рубинового источника энергии возобновляются...

Изображение

Изображение
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#19 Kushelev » 19.01.2017, 13:36

Формы, механизмы, энергия наномира. Сообщение 84 611

Вышел 586-ой выпуск рассылки "Новости лаборатории Наномир"

http://subscribe.ru/catalog/science.news.nanoworldnews

Дайджест:

586 Заявки на научные открытия.
Явление взаимодействия токов проводимости и смещения с эфиром Фарадея-Максвелла.
Обнаружены дисульфидные мостики Met-Cys!
Композиционный код 6
Обнаружен новый тип вторичной структуры белка!
Изображение
Изображение
Изображение
Изображение
Изображение
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#20 МАУС » 19.01.2017, 14:44

Опять спам и шизофренический лженаучный бред! :mad:
МАУС
Аватара
Откуда: СССР
Репутация: 46 (+46/−0)
Лояльность: 55
Сообщения: 344
Темы: 9
Зарегистрирован: 30.05.2016
С нами: 7 месяцев 23 дня

#21 Kushelev » 19.01.2017, 23:03

Пикотехнология белков, ДНК, РНК - 2

Новая технология обнаружения кодов белков в геноме

Кушелев: Удалось найти код длинной метиониновой спирали:

Изображение
По алгоритму Виктории Соколик метиониновая спираль не является вторичной структурой белка :)

Посмотрим, что покажет Пикотех-2017:

Изображение
Обратите внимание, что последним аминокислотным остатком в спирали является не метионин. Это значит, что метионин был нужен именно для получения спирали с более крупным шагом.

Любопытно, что алгорим Виктории Соколик в данном случае не показал метиониновую спираль, но показал спираль в другом месте, где её по алгоритму Пикотех-2017 нет.

Очень интересно построить 3D модель этого белка или белкового фрагмента (это ещё предстоит выяснить). А вообще появилась новая технология обнаружения кодов белков в геноме по структурному критерию.
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#22 Kushelev » 20.01.2017, 11:33

Формы, механизмы, энергия наномира. Сообщение 84 645

Пикотехнология белков, ДНК, РНК - 2

Изображение

http://www.rcsb.org/pdb/explore/explore.do?structureId=5J4B

http://www.uniprot.org/uniprot/P60405

http://www.ebi.ac.uk/ena/data/view/BAD71512

>ENA|BAD71512|BAD71512.1 Thermus thermophilus HB8 50S ribosomal protein L2
ATGGCCGTTAAGAAGTTCAAACCCTACACCCCGAGCCGCCGCTTCATGACGGTGGCCGAC
TTCTCCGAGATCACCAAGACGGAGCCCGAGAAGTCCCTGGTCAAGCCCCTGAAGAAGACG
GGGGGGCGGAACAACCAGGGGCGGATCACGGTGCGCTTCCGCGGCGGCGGCCACAAGCGC
TTGTACCGCATCATTGACTTCAAGCGCTGGGACAAGGTGGGCATCCCCGCCAAGGTGGCG
GCCATTGAGTACGACCCCAACCGCTCGGCCCGCATCGCCCTGCTCCACTACGTGGACGGG
GAGAAGCGGTACATCATCGCCCCGGACGGCCTCCAGGTGGGGCAGCAGGTGGTGGCGGGT
CCCGACGCCCCCATTCAGGTGGGCAACGCCCTGCCCCTGCGCTTCATCCCCGTGGGCACC
GTGGTCCACGCCGTGGAGCTTGAGCCCAAGAAGGGGGCCAAGCTGGCCCGCGCCGCCGGG
ACCAGCGCCCAGATCCAGGGCAGGGAAGGGGATTACGTGATCCTGCGCCTGCCTTCCGGG
GAGCTTAGGAAGGTGCACGGGGAGTGCTACGCCACGGTGGGCGCCGTGGGCAACGCCGAC
CACAAGAACATCGTCCTGGGCAAGGCGGGCCGCAGCCGCTGGCTCGGCCGCAGGCCTCAC
GTCCGCGGCGCCGCCATGAACCCGGTGGACCACCCCCACGGCGGCGGCGAGGGCCGGGCG
CCCCGGGGTCGTCCTCCCGCCTCGCCTTGGGGCTGGCAGACCAAGGGGCTCAAGACCAGG
AAGCGGCGTAAGCCTTCCAGCCGCTTCATCATCGCCCGTCGCAAGAAGTGA

Изображение

http://www.uniprot.org/uniprot/Q5SHN8

http://www.ebi.ac.uk/ena/data/view/BAD71515

>ENA|BAD71515|BAD71515.1 Thermus thermophilus HB8 50S ribosomal protein L3
GTGAAGGGCATCTTGGGCGTCAAGGTGGGCATGACCCGCATCTTCCGCGACGACCGCGCC
GTCCCCGTCACGGTCATCCTTGCGGGGCCGTGCCCCGTGGTGCAGCGCCGCACCCCGGAG
AAGGACGGCTACACCGCGGTGCAGCTGGGCTTCCTTCCCCAAAACCCCAAGCGGGTGAAC
CGCCCCCTTAAGGGGCACTTCGCCAAGGCCGGGGTGGAGCCCGTGCGCATCCTGCGGGAG
ATCCGGGACTTCAACCCCGAAGGCGACACGGTCACGGTGGAGATCTTCAAGCCCGGGGAG
CGCGTGGACGTGACGGGCACCTCCAAGGGCCGGGGCTTCGCCGGCGTGATGAAGCGCTGG
AACTTCGCGGGCGGCCCCGACTCCCACGGCGCCCACAAGATCCACCGCCACCCCGGCTCC
ATCGGGAACCGCAAGACCCCCGGTCGCGTCTACAAGGGCAAGAAGATGGCGGGCCACTAC
GGGGCCGAGCGCGTGACGGTCATGAACCTCGAGGTGGTGGACGTCATCCCCGAGGAGAAC
CTGCTTTTGGTCAAGGGGGCCGTCCCCGGTCCCAACGGCGGCCTGGTCATCGTCCGCGAG
ACCAAGAAGGCGGCCAAGTGA

Изображение

http://www.uniprot.org/uniprot/Q5SHN9

http://www.ebi.ac.uk/ena/data/view/AAA97862

>ENA|AAA97862|AAA97862.1 Thermus thermophilus ribosomal protein L4
GTGAAGGAGGTAGCGGTGTACCAGATTCCCGTCCTTTCCCCTAGCGGCAGGCGCGACGTT
GCCGCCGACCTGCCCGCGGAGATCAACCCCCACCTCCTCTGGGAGGTGGTCCGGTGGCAG
CTGGCCAAGCGCCGCCGAGGCACCGCCAGCACCAAGACCCGGGGCGAGGTTGCCTACTCC
GGCCGGAAGATCTGGCCGCAGAAGCACACCGGCCGTGCCCGCCACGGGGACATCGGCGCC
CCCATCTTCGTGGGCGGCGGCGTGGTCTTCGGTCCCAAGCCCCGGGACTACAGCTACACC
CTGCCCAAGAAGGTCCGGAAGAAGGGGCTCGCCATGGCCGTGGCCGACCGGGCCCGGGAG
GGGAAGCTCCTCCTCGTGGAGGCGTTTGCCGGGGTCAACGGCAAGACCAAGGAGTTCCTG
GCCTGGGCCAAGGAGGCGGGCCTGGACGGCTCCGAGAGCGTCCTCCTGGTGACCGGAAAC
GAGCTGGTCCGCCGGGCGGCCCGCAACCTGCCCTGGGTGGTGACCCTGGCCCCGGAGGGG
CTCAACGTCTACGACATCGTCCGTACGGAGCGGCTGGTCATGGACCTGGACGCTTGGGAG
GTCTTCCAGAACCGCATAGGGGGTGAGGCGTGA

Изображение

Добавлено спустя 38 минут 33 секунды:
Формы, механизмы, энергия наномира. Сообщение 84 647

Пикотехнология белков, ДНК, РНК - 2

http://www.rcsb.org/pdb/explore/explore.do?structureId=4IWB

Изображение
Кушелев: Специалисты по РСА не угадали тип структуры этого белка...

http://www.uniprot.org/uniprot/O67806

http://www.ebi.ac.uk/ena/data/view/AAC07766

>ENA|AAC07766|AAC07766.1 Aquifex aeolicus VF5 flagellar protein FliS
ATGAGAAACATTGCAGAGGCTTACTTTCAAAATATGGTAGAAACCGCCACACCTCTTGAG
CAGATAATACTCCTCTACGATAAAGCGATAGAATGCTTAGAAAGGGCTATAGAGATATAC
GATCAAGTAAATGAACTTGAAAAGAGAAAGGAATTTGTGGAAAACATAGACAGAGTTTAC
GACATCATCAGTGCATTAAAGTCCTTTTTAGATCACGAAAAAGGAAAAGAAATAGCTAAA
AATCTGGACACGATTTACACTATAATCCTGAATACTCTCGTTAAAGTGGATAAAACCAAG
GAAGAACTCCAGAAAATTCTGGAAATTTTAAAAGATTTAAGGGAAGCATGGGAGGAAGTG
AAGAAGAAGGTTTAA

Изображение
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#23 Kushelev » 20.01.2017, 16:47

Формы, механизмы, энергия наномира. Сообщение 84 653

Пикотехнология белков, ДНК, РНК - 2

Skype:

[19.01.2017 17:03:19] Кушелев Александр Юрьевич: В таблице 3 разных TKD (терминирующих кодона).
[19.01.2017 17:03:26] Кушелев Александр Юрьевич: Картинка правильная
[19.01.2017 17:03:34] Va12220(valqwa): вот и пиши разъясняй
[19.01.2017 17:03:42] Va12220(valqwa): я домой
[19.01.2017 17:04:26] Кушелев Александр Юрьевич: Картинка правильная для var 4
[19.01.2017 17:04:44] Кушелев Александр Юрьевич: Она же должна повториться и в столбце var 6
[19.01.2017 17:05:10] Кушелев Александр Юрьевич: TKD не нужно ни на что менять.
[19.01.2017 17:05:41] Кушелев Александр Юрьевич: А композиционный код у TKD лучше сделать не "1", а "0"
[19.01.2017 17:05:54] Кушелев Александр Юрьевич: И никогда не менять
[19.01.2017 17:06:36] Кушелев Александр Юрьевич: В таблице композиционного кода придётся исправить коды для TKD
[19.01.2017 17:06:45] Кушелев Александр Юрьевич: На "0"
[19.01.2017 18:07:47] Кушелев Александр Юрьевич: И всё же непонятно, почему твоя программа выводит картинку через полчаса, а программа от Prosolver через 1 секунду? В чём секрет?
[19.01.2017 18:09:16] Кушелев Александр Юрьевич: Быстродействие отличается в несколько тысяч раз!
[19.01.2017 18:27:59] Va12220(valqwa): потому что в среде выполняется программа
http://rsload.net/news/25611-uchenye-sdelali-iz-nokia-lumia-1020-mikroskop-dlya-analiza-dnk.html
[19.01.2017 18:47:00] Va12220(valqwa): но как тогда анализировать комп код. если появится ещё и 0 - счетчик что будет делать?
[19.01.2017 19:17:29] Кушелев Александр Юрьевич: Сбрасываться
[19.01.2017 19:17:55] Кушелев Александр Юрьевич: На терминирующем коде белок заканчивается. После него начинается новый белок
[19.01.2017 19:18:20] Кушелев Александр Юрьевич: Может быть тормозит сильно из-за динамического перераспределения памяти?
[19.01.2017 19:18:24] Va12220(valqwa): т.е. счетчик надо обнулять?
[19.01.2017 19:18:27] Кушелев Александр Юрьевич: Задать массивы сразу по максимуму
[19.01.2017 19:18:30] Кушелев Александр Юрьевич: Да
[19.01.2017 19:19:17] Кушелев Александр Юрьевич: Полчаса ждать это некуда не годится.
[19.01.2017 19:19:46] Кушелев Александр Юрьевич: Попробуй задать массивы статически
[19.01.2017 19:22:44] Кушелев Александр Юрьевич: А твоя программа dne ещё не понимает?
[19.01.2017 19:24:00] Va12220(valqwa): это легко сделать. сначала поправлю это

на любом из 3х терм коде сбрасывать счетчик и начинать новый белок
[19.01.2017 19:27:42] Кушелев Александр Юрьевич: Да
[19.01.2017 19:33:48] Va12220(valqwa): хорошо. отдыхай. )
[1:35:55] Кушелев Александр Юрьевич: Привет!
[1:36:14] Кушелев Александр Юрьевич: Что-то с этим файлом fasta твоя программа работать отказывается:
[1:36:15] Кушелев Александр Юрьевич: >ENA|LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
AAGGCCAACAAGGCCGCCCGCACCCGTGATGTTTTCAACGACAAAGTTGATACCCATCTGCGTAGAAA
GTGCGCTGGTGACGTAACGCACTGCGATGTCTGAGGCGCTGCCGGCCTGCAAGGGGAGCCCCACGGTCAC
CGGATTGCCGAAGCTGTGTTTTTGAGCCATTGATAAACTGGGCCAAAAGGCGACGCCACAGGCTGCTGCG
CCTGCTTTGAGAAAGGTTCTTTTAATCATTAAGTCTCTCGCTGCCCACATTAGGGTCAAAATGTTTAACC
TTAGTATTTGAAATTTACTCTGTTTTTGAGATGATGTCACATGTCAAAATAAGGCTGACTAAATGGTCAA
ATGTTGACTGGAAAAGGTAGTCGTCGGGAAGGCGCGGATGATGATGGTGTGGTGGTGGTGATGATGATGA
TGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[1:36:33] Кушелев Александр Юрьевич: Этот файл я взял отсюда: https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=fasta
[1:37:01] Кушелев Александр Юрьевич: Там можно взять dne-файл этого же белка: https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=genbank
[1:37:35] Кушелев Александр Юрьевич: Т.е. код var4 она сделала, а код var6 не хочет делать :)
[1:37:52] Кушелев Александр Юрьевич: Появлюсь минут через 20
[1:38:06] Va12220(valqwa): ага. как раз разберусь надеюсь
[1:38:25] Кушелев Александр Юрьевич: Кстати, программа Prosolver тоже не хочет работать именно с этим файлом и dne тоже!
[1:39:25] Va12220(valqwa): не страшно сейчас заработает. я ввел код 0
с ним разберусь и с этим тоже. 20 мин
[1:42:34] Va12220(valqwa): 1 - композитный код 0 я понимаю как останов счетчика так же как и с 2 и 3 - согласен ?
2 - далее я поступаю так же как было в случах 2 и 3 ? или тут особый случай?
в случаях 2 и 3 я меня предшествующие последоватеьлности на последовательности 5к и 4к
[1:46:36] Va12220(valqwa): полагаю тут то же самое.
[1:50:52] Va12220(valqwa): кстати в последнем фаста на 183 дкн группы аж!!! 41 включение Мет аминокислот
[1:56:57] Va12220(valqwa): и в "поправленном " алгоритме
отработало
[1:57:48] Va12220(valqwa): ет аминокислоты - это код 6 и фиолетовый кирпичег
[2:08:07] Кушелев Александр Юрьевич: ЗдОрово! Да. Просто сброс счётчика. А почему не работала прога на этом белке?
[2:08:53] Va12220(valqwa): не знаю. я же уже её передописал. она сейчас немного "лучше"
[2:08:53] Кушелев Александр Юрьевич: Там в фасте нужно убрать первый символ кода
[2:09:48] Кушелев Александр Юрьевич: >ENA|LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
AAGGCCAACAAGGCCGCCCGCACCCGTGATGTTTTCAACGACAAAGTTGATACCCATCTGCGTAGAAA
GTGCGCTGGTGACGTAACGCACTGCGATGTCTGAGGCGCTGCCGGCCTGCAAGGGGAGCCCCACGGTCAC
CGGATTGCCGAAGCTGTGTTTTTGAGCCATTGATAAACTGGGCCAAAAGGCGACGCCACAGGCTGCTGCG
CCTGCTTTGAGAAAGGTTCTTTTAATCATTAAGTCTCTCGCTGCCCACATTAGGGTCAAAATGTTTAACC
TTAGTATTTGAAATTTACTCTGTTTTTGAGATGATGTCACATGTCAAAATAAGGCTGACTAAATGGTCAA
ATGTTGACTGGAAAAGGTAGTCGTCGGGAAGGCGCGGATGATGATGGTGTGGTGGTGGTGATGATGATGA
TGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[2:10:43] Va12220(valqwa): зачем ?
[2:10:48] Кушелев Александр Юрьевич: Вот такой композиционный код выдала твои прога перед обломом:
[2:10:49] Кушелев Александр Юрьевич: 1,1,1,1,1,1,1,1,3,3,3,1,1,1,3,3,3,1,3,4,3,3,1,1,3,3,1,2,4,1,1,3,1,1,1,3,1,1,4,3,4,1,1,1,3,1,4,3,1,3,
3,4,3,1,1,3,1,1,3,4,2,3,1,1,1,2,1,1,1,1,1,3,1,3,3,3,3,3,3,1,1,3,1,1,2,3,1,3,3,3,3,1,3,1,3,1,3,3,3,4,
3,1,3,1,3,1,1,2,3,1,1,1,2,3,3,3,1,1,3,2,3,3,3,3,4,3,1,4,3,3,3,3,4,4,4,4,1,1,1,1,1,1,1,1,1,4,4,4,4,4,
4,4,4,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,1,
[2:11:15] Кушелев Александр Юрьевич: ммммм - это спираль из 11111
[2:12:00] Кушелев Александр Юрьевич: А, я не увидел конец картинки. Всё ОК
[2:12:08] Кушелев Александр Юрьевич: Давай программу :)
[2:12:21] Va12220(valqwa): TKD делаю.
[2:12:53] Кушелев Александр Юрьевич: ОК
[2:14:02] Кушелев Александр Юрьевич: И всё же непонятно, почему твоя прога и прога от Prosolver не работали на этом белке?
[2:20:30] Va12220(valqwa): основное время занимает в моей программе формирование картинки. её я формирую в памяти сначала программным образом, что "долго" с одной стороны и требует достаточно большого выделения именно динамической памяти как ты говорил. т.е. каждая операция меняет память.
[2:21:10] Va12220(valqwa): у меня пропадает при выводе строка с TDK обозначением. сейчас отыщу где "пропадает" поправлю и вышлю тебе
[2:23:26] Кушелев Александр Юрьевич: А нельзя динамическое выделение памяти поменять на статическое?
[2:23:56] Кушелев Александр Юрьевич: Быстродействие для меня очень важно...
[2:24:32] Va12220(valqwa): я думаю как это изменить
[2:31:33] Va12220(valqwa): с прерываниями поправил.
экспериментируй. алгоритм возможно не идеален
[2:31:45] Va12220(valqwa): сейчас перекину папочку
[2:33:58] Кушелев Александр Юрьевич: Благодарю!
[2:38:58] Кушелев Александр Юрьевич: А когда перекинешь-то?
[2:40:01] Va12220(valqwa): уже перекинул
[2:40:05] Кушелев Александр Юрьевич: Спасибо! Завтра утром займусь
[2:40:12] Кушелев Александр Юрьевич: Спокойной ночи!
[2:40:34] Va12220(valqwa): Ночи. я пока что DNE "добавлю"
[2:41:18] Va12220(valqwa): ты учти - что программа перебирает и обрабатывает подряд все файлы в папке.
если что-то обработал и тебе это уже не нужно - выноси из папки
[2:41:29] Кушелев Александр Юрьевич: ОК
[2:41:31] Va12220(valqwa): а то сутками можешь пересчитывать посчитанное
[4:56:23] Va12220(valqwa): этот релиз может читать и дне (embl) формат
обрати внимание на то , как этот формат EMBL представляется.
я приложил 2 файла fasta и один embl.
данный embl скачивал непосредственно с сайта, который ты мне указал.

если запустить данную программу, поместив внутри несколько файлов (как в данной папочке)
то они все три (их там 3) просчитаются по очереди
сначала файлы fasta
затем embl
[4:58:14] Va12220(valqwa): у меня все эти 3 файлика вместе просчитываются за время менее 20 секунд
[5:01:20] Va12220(valqwa): а точнее
Elapsed time is 11.341182 seconds.
[9:03:52] Кушелев Александр Юрьевич: Круто! Благодарю! Сейчас буду пробовать.
[9:06:25] Кушелев Александр Юрьевич: Запустил в 9:05
[9:07:21] Кушелев Александр Юрьевич: 9:07 два файла посчиталось с картинками
[9:09:26] Кушелев Александр Юрьевич: Вероятно и третий тоже. Я его не заметил, т.к. он очень широкую и короткую картинку сделал.
[9:10:44] Кушелев Александр Юрьевич: А этот у тебя сколько секунд считается?
[9:11:28] Кушелев Александр Юрьевич: И особенно этот: https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=genbank
[9:11:45] Кушелев Александр Юрьевич: У меня полчаса
[9:37:50] Кушелев Александр Юрьевич: Вот такой файл не хочет считаться:
[9:37:51] Кушелев Александр Юрьевич: >LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
GATGATGGTGTGGTGGTGGTGATGATGATGA
TGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[9:39:26] Кушелев Александр Юрьевич: Выравнивание строк не спасает:
[9:39:27] Кушелев Александр Юрьевич: >LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
GATGATGGTGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGACGGTGGTGGTG
GTGGTGGTGGTGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATG
ATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[9:44:31] Кушелев Александр Юрьевич: Вот с этим файлом считать не хочет
[9:47:21] Кушелев Александр Юрьевич: Изменение числа символов в строке не помогает
[9:54:55] Кушелев Александр Юрьевич: Вроде считает, но уже больше двух минут. А там файл-то маленький...
[9:56:39] Кушелев Александр Юрьевич: 4 минуты прошло. Даже коды не выводит.
[10:00:45] Кушелев Александр Юрьевич: А, там была ошибка в CDS
[10:01:15] Кушелев Александр Юрьевич: Нужно будет контроль входных данных делать...
[10:02:54] Кушелев Александр Юрьевич: Всё равно не работает с этим файлом.
[10:03:08] Кушелев Александр Юрьевич: И никакого сообщения диагностического не выдаётся
[10:52:37] Va12220(valqwa): по поводу ДНЕ - ты скорее всего, как я понимаю выцепляешь последовательность методом "скопировать выделенное" с сайта и это скопированное поместить в файл, который ты сам и создал

я специально тебе сказал - есть правила формирования формата - файл должен быть сформирован по этому правилу.

я ведь не копирую файлы дне а "скачиваю" с сайта как файлы.

m30_dne.dne
как называется этот белок ?
ссылка на сайте ?
[10:58:05] Кушелев Александр Юрьевич: Тут дело не в формате.
[10:58:24] Кушелев Александр Юрьевич: Достаточно добавить или убавить один символ в последовательности, и программа начинает работать
[10:58:36] Кушелев Александр Юрьевич: Тут дело именно в комбинации символов входного кода
[10:59:47] Кушелев Александр Юрьевич: Со сдвинутой рамкой считывания на 1 и на 2 символа программа работает. Кстати, у Prosolver та же ситуация ...
[11:00:15] Кушелев Александр Юрьевич: А со сдвигом на 0, 3, 6, 9 символов программы (обе!) отказываются считать.
[12:11:13] Va12220(valqwa): сейчас посмотрю в чем дело (изнутри)
[12:13:04] Кушелев Александр Юрьевич: ОК
[12:15:23] Va12220(valqwa): последняя картинка это твой файл m30_dne ?
[12:20:33] Кушелев Александр Юрьевич: Программа должна выдать это:

Изображение
[12:20:51] Va12220(valqwa): последняя картинка это твой файл m30_dne ?
[12:24:33] Кушелев Александр Юрьевич: Вот что говорит программа от Prosolver на этот файл:

Изображение

А это сообщение твоей программы:

Изображение

[12:24:42] Кушелев Александр Юрьевич: Твоя тоже ругается и ничего не делает.
[12:25:37] Кушелев Александр Юрьевич: Любопытно, что всю структуру целиком твоя программа показала :)
[12:25:42] Va12220(valqwa): Саша, эта последовательность есть на сайте ?
https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=genbank
[12:25:55] Кушелев Александр Юрьевич:

Изображение
[12:26:09] Кушелев Александр Юрьевич: Это кусок последовательности
[12:26:38] Кушелев Александр Юрьевич: Целую последовательность программа обрабатывает корректно
[12:26:56] Кушелев Александр Юрьевич: А обрезанную не хочет
[12:27:26] Va12220(valqwa): ясно. то ты сам сгенерил файл. из последовательности.
значит ты неправильно сгенерил эту последовательность. мне тут сложно тебе помочь. я увы правил генерации, и правил правильного вырезания кусков - не знаю
[12:27:42] Va12220(valqwa): ссулку на целую последовательность дай
[12:28:03] Кушелев Александр Юрьевич: Я не мог её неправильно сгенерировать, т.к. все последовательности должны обрабатываться по нашему алгоритму без исключения
[12:29:43] Кушелев Александр Юрьевич: >ENA|LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
AAGGCCAACAAGGCCGCCCGCACCCGTGATGTTTTCAACGACAAAGTTGATACCCATCTGCGTAGAAA
GTGCGCTGGTGACGTAACGCACTGCGATGTCTGAGGCGCTGCCGGCCTGCAAGGGGAGCCCCACGGTCAC
CGGATTGCCGAAGCTGTGTTTTTGAGCCATTGATAAACTGGGCCAAAAGGCGACGCCACAGGCTGCTGCG
CCTGCTTTGAGAAAGGTTCTTTTAATCATTAAGTCTCTCGCTGCCCACATTAGGGTCAAAATGTTTAACC
TTAGTATTTGAAATTTACTCTGTTTTTGAGATGATGTCACATGTCAAAATAAGGCTGACTAAATGGTCAA
ATGTTGACTGGAAAAGGTAGTCGTCGGGAAGGCGCGGATGATGATGGTGTGGTGGTGGTGATGATGATGA
TGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[12:30:28] Кушелев Александр Юрьевич: Вот сайт: https://www.ncbi.nlm.nih.gov/nuccore/1039188734
[12:31:30] Кушелев Александр Юрьевич: Любая комбинация символов ACGT... должна отрабатываться программой
[12:31:54] Va12220(valqwa): ты намешал кучу. начал с дне а заканчиваешь фастой.
зря я тебе сделал обработку embl файла. ты только сам запутался и ещё путаешь и меня (и наверное все остальных)

поэтому давай ограничимся пока что фастой, поскольку ты физически неверно задаёшь структуру embl файла, когда делаешь это саморучно (так называемый "новодел Кушелева" однозначно неверен по формату). Отсюда и все пауки в твоей голове.
[12:33:21] Кушелев Александр Юрьевич: Нет. На сайте есть и dne-файл: https://www.ncbi.nlm.nih.gov/nuccore/1039188734
и фаста: https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=fasta
[12:33:30] Кушелев Александр Юрьевич: Я оба варианта проверял.
[12:33:55] Кушелев Александр Юрьевич: Если сдвинуть начало белка на один или два символа, то программа работает и выдаёт правильные результаты:
[12:34:57] Va12220(valqwa): я тебе верю. но на всякий случай скачал аналог embl твоей ссылки в ПРАВИЛЬНОМ виде
[12:36:10] Кушелев Александр Юрьевич: Обе программы, т.е. и от Prosolver, и твоя отказываются обрабатывать только один из трёх вариантов последовательности, когда должна получиться такая картинка:

Изображение
[12:38:16] Va12220(valqwa): не суетись.ю разбираемся дальше.
правильно скачанный файл я обработал и получил следующе:
смотри выше
[12:38:19] Кушелев Александр Юрьевич: Это со сдвигом на один или два символа
[12:38:29] Va12220(valqwa): теперь скажи что ты такое с этим файлом сделал
[12:38:49] Va12220(valqwa): нет. это без сдвигов. это вот так как эта последовательность записана на сайте
[12:39:04] Кушелев Александр Юрьевич: При убирании одного символа кода картинка должна радикально измениться. Другие аминокислотные остатки получатся
[12:39:18] Кушелев Александр Юрьевич: При убирании второго (от начала) символа ещё раз
[12:39:23] Va12220(valqwa): например какой символ (код ) ты убрал
[12:39:51] Кушелев Александр Юрьевич: А если третий символ убрать, то уберётся первый аминокислотный остаток по сравнению с тем, где на три символа было больше
[12:40:07] Va12220(valqwa): успокойся.
[12:40:12] Кушелев Александр Юрьевич: TCAAGGCCAACAAGGCCGCCCGCACCCGTGATGTTTTCAACGACAAAGTTGATACCCATCTGCGTAGAAA
GTGCGCTGGTGACGTAACGCACTGCGATGTCTGAGGCGCTGCCGGCCTGCAAGGGGAGCCCCACGGTCAC
CGGATTGCCGAAGCTGTGTTTTTGAGCCATTGATAAACTGGGCCAAAAGGCGACGCCACAGGCTGCTGCG
CCTGCTTTGAGAAAGGTTCTTTTAATCATTAAGTCTCTCGCTGCCCACATTAGGGTCAAAATGTTTAACC
TTAGTATTTGAAATTTACTCTGTTTTTGAGATGATGTCACATGTCAAAATAAGGCTGACTAAATGGTCAA
ATGTTGACTGGAAAAGGTAGTCGTCGGGAAGGCGCGGATGATGATGGTGTGGTGGTGGTGATGATGATGA
TGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[12:40:15] Va12220(valqwa): ещё раз. какой символ убрать ?
[12:40:24] Кушелев Александр Юрьевич: Первый символ T
[12:40:53] Кушелев Александр Юрьевич: А кто тебе сказал, что я не спокоен?
[12:41:32] Va12220(valqwa): суетишься. не можешь остановиться.

т.е. если убрать в первом рядочке последовательности
tcaaggccaa caaggccgcc cgcacccgtg atgttttcaa cgacaaagtt gatacccatc
симовл t
то получится строка
caaggccaa caaggccgcc cgcacccgtg atgttttcaa cgacaaagtt gatacccatc
и далее все остальное. верно ?
[12:41:47] Кушелев Александр Юрьевич: Да
[12:42:07] Va12220(valqwa): и вот при убранном t программа перестает работать
так ?
[12:42:09] Кушелев Александр Юрьевич: А в следующий раз убирай ещё один символ. Должна получиться третья картинка
[12:42:26] Кушелев Александр Юрьевич: Программа работает в двух вариантах из трёх
[12:42:38] Va12220(valqwa): и вот при убранном t программа перестает работать
так ?
[12:42:55] Va12220(valqwa): ты ответь на вопрос. потом остальное напишешь. если надо будет
[12:42:56] Кушелев Александр Юрьевич: Либо так, либо ещё один символ нужно убрать
[12:43:15] Кушелев Александр Юрьевич: Я не могу держать в голове последовательность символов :)
[12:43:44] Va12220(valqwa): ещё раз.
спрашиваю.
если в последовательности убрать первый символ t
ПРОГРАММА РАБОТАТЬ ОТКАЗЫВАЕТСЯ???
один только символ убрать. мой вопрос непонятен?
[12:44:04] Кушелев Александр Юрьевич: Для ответа мне придётся ещё раз запускать твою прогу
[12:44:10] Кушелев Александр Юрьевич: Я не помню, один или два
[12:44:30] Va12220(valqwa): но sn при этом не написал статью целую уже. вместо того чо бы ответить на вопрос.
[12:44:41] Кушелев Александр Юрьевич: Жди
[12:45:23] Va12220(valqwa): отвечаю за тебя - не будет работать.
объясняю почему
[12:46:40] Va12220(valqwa): потому что твой алгоритм преобразования аминокислотной цепочки рассчитан на обработку последовательностей из 3х "буквочек"
т.е. количество "буквочек" в цепочке должно быть кратно трем
как олько ты убираешь однку буквочку - кратность трем нарушается.
[12:48:01] Кушелев Александр Юрьевич: В программе от Prosolver выдаётся сообщение "не кратно трём" и последние две или один символ последовательности игнорируются
[12:48:09] Кушелев Александр Юрьевич: У тебя тоже так вроде было
[12:48:38] Va12220(valqwa): ну извини, ты меня не предупреждал, что ты будешь делать "новоделы Кушелева"
[12:49:04] Va12220(valqwa): хотя ограничение я вроде бы на условие кратности поставил по умолчанию
[12:49:27] Кушелев Александр Юрьевич: Так в файле fasta кратности нет.
[12:49:48] Кушелев Александр Юрьевич: А в файле dne кратность должна быть указана в CDS
[12:50:08] Кушелев Александр Юрьевич: Выдавать сообщение о некратности не обязательно
[12:51:16] Va12220(valqwa): А в файле dne кратность должна быть указана в CDS

не вижу

посмотри посл файл embl и скажи какая кратность там в CDS
[12:51:37] Кушелев Александр Юрьевич: Вот этот файл не отрабатывается: >LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
AAGGCCAACAAGGCCGCCCGCACCCGTGATGTTTTCAACGACAAAGTTGATACCCATCTGCGTAGAAA
GTGCGCTGGTGACGTAACGCACTGCGATGTCTGAGGCGCTGCCGGCCTGCAAGGGGAGCCCCACGGTCAC
CGGATTGCCGAAGCTGTGTTTTTGAGCCATTGATAAACTGGGCCAAAAGGCGACGCCACAGGCTGCTGCG
CCTGCTTTGAGAAAGGTTCTTTTAATCATTAAGTCTCTCGCTGCCCACATTAGGGTCAAAATGTTTAACC
TTAGTATTTGAAATTTACTCTGTTTTTGAGATGATGTCACATGTCAAAATAAGGCTGACTAAATGGTCAA
ATGTTGACTGGAAAAGGTAGTCGTCGGGAAGGCGCGGATGATGATGGTGTGGTGGTGGTGATGATGATGA
TGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGA
[12:52:26] Va12220(valqwa): это фаста без первых 2х символов ?
[12:52:57] Va12220(valqwa): сейчас проверю
[12:53:14] Кушелев Александр Юрьевич: microb_0 и microb_1 отрабатываются корректно, а microb_2 только код-4 выдаётся, а код-6 уже не выдаётся и картинка тоже
[12:54:26] Кушелев Александр Юрьевич: Да, без двух первых символов. Но если уберёшь ещё 3 или 3 добавишь, то всё-равно не работает. А если добавить или убрать не кратно 3, то будет работать.
[12:55:17] Кушелев Александр Юрьевич: Самое загадочное, что у Prosolver та же ситуация
[12:55:44] Кушелев Александр Юрьевич: Ты вчера уже исправлял. Целый файл у тебя стал работать
[12:55:53] Va12220(valqwa): погоди проверяю.

и так первый microb_0 - работает корректно - это неизмененная цепочка с сайта
[12:55:55] Кушелев Александр Юрьевич: А обрезанный кусок не хочет
[12:56:28] Кушелев Александр Юрьевич: Да, но это не последовательность реального белка. Это "со сбитой рамкой настройки"
[12:56:43] Кушелев Александр Юрьевич: Реальный белок кодируется как раз без двух первых символов
[12:58:57] Кушелев Александр Юрьевич: Вот последовательность аминокислотных остатков реального белка: /translation="MLTGKGSRREGADDDGVVVVMMMMMMMMMTVVVVVVVMMMMMMM
MMMMMMMMMMMMMMMMMMMMMMM"
[12:59:00] Va12220(valqwa): я понимаю. "новодел Кушелева" )
microb_1 - тут убран 1й символ. (вообще то говоря и вся структура как бы полностью меняется, поскольку кодовые тройки абсолютно иными становятся.)
ПОСЧИТАЛОСЬ (6 сек)
[12:59:13] Кушелев Александр Юрьевич: Взято с сайта: https://www.ncbi.nlm.nih.gov/nuccore/1039188734
[12:59:42] Va12220(valqwa): сейчас посмотрим что происходит если убрать первые 2 символа
микро_2
[13:00:01] Кушелев Александр Юрьевич: Да. Без одного символа считается корректно. Но со всеми символами и без одного символа - это не коды реального белка.
[13:00:12] Кушелев Александр Юрьевич: Код реального белка - без двух символов
[13:00:31] Va12220(valqwa): сек. смотрю
[13:05:37] Кушелев Александр Юрьевич: А потом интересно узнать, сколько секунд у тебя будет отрабатываться этот файл: https://www.ncbi.nlm.nih.gov/nuccore/614458216
[13:07:50] Кушелев Александр Юрьевич: Кстати, в DNE-файле рамка не сбита: https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=genbank
[13:13:38] Va12220(valqwa): меняю отсекание "лишнего" остатка при приверке. сек
[13:36:34] Va12220(valqwa): смотри в данном новоделе Кушелева последний триплекс - ATG
в этом случае "включается" проверка - какой же сл символ - а сл символа то нет - поэтому и сбоит программа. сейчас поменяю условия проверки. в случае если это конец цепочки
[13:37:46] Кушелев Александр Юрьевич: Ура! Вероятно у Prosolver то же было
[13:39:32] Va12220(valqwa): последний Мет менять на 1 или 6-ку код ?
[13:40:04] Кушелев Александр Юрьевич: На "1"
[13:41:15] Кушелев Александр Юрьевич: Появлюсь через часа полтора
[14:13:00] Va12220(valqwa): лови. исправил. вроде бы "новодел" кушелева" теперь работает
[14:26:31] Va12220(valqwa): да. посчиталось быстро 4 и 6 коды. а вот картинка все ещё строится (((
это не есть хорошо. буду сейчас думать как ускорить этот процесс
всего 16179 кодов в этой последовательности
а это получается изоражение размером 300(ширина) на 320000(высота) пикселов
[14:59:34] Va12220(valqwa): Elapsed time is 2426.533488 seconds. или 40 минут

практически 40 минут и строило изображение ..... жуть
[15:26:44] Кушелев Александр Юрьевич: ЗдОрово! А этот "новодел" тоже работает?
https://www.ncbi.nlm.nih.gov/nuccore/1039188734?report=genbank
[15:32:07] Кушелев Александр Юрьевич: 15:28 ... 15:29 - "новодел" посчитался и вывелась картинка за 1 минуту. Уже неплохо.
[15:33:43] Кушелев Александр Юрьевич: У тебя 40 минут и у меня где-то столько же. А ты уже заменил динамические массивы на статические?
[15:34:07] Va12220(valqwa): нет. с графикой пока что разбираюсь как ускорить.
[15:36:05] Кушелев Александр Юрьевич: Ну так там, вероятно, тоже массивы динамические
[15:46:48] Кушелев Александр Юрьевич: "Новодел Кушелева" на моём компьютере считается меньше минуты по этому коду:
[15:47:08] Кушелев Александр Юрьевич: >LJOW01000961.1 Aphanizomenon flos-aquae WA102 165964, whole genome shotgun sequence
CTAAATGGTCAAATGTTGACTGGAAAAGGTAGTCGTCGGGAAGGCGCGGATGATGATGGTGTGGTGGTGG
TGATGATGATGATGATGATGATGATGATGACGGTGGTGGTGGTGGTGGTGGTGATGATGATGATGATGAT
GATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATGATG
ATGA
Изображение
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#24 Kushelev » 20.01.2017, 17:18

Формы, механизмы, энергия наномира. Сообщение 84 655

Парадокс Левинталя


Цитата: Парадо́кс Левинта́ля — известный парадокс, который сформулировал в 1968 году Сайрус Левинталь: «промежуток времени, за который полипептид приходит к своему скрученному состоянию, на много порядков меньше, чем если бы полипептид просто перебирал все возможные конфигурации»[1][2].

Кушелев: Всё верно! Парадокс исчезает с открытием композиционного генетического кода, реализованного механизмом рибосомы и тРНК:

Изображение
Подробнее: http://nanoworld88.narod.ru/data/212.htm
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#25 Kushelev » 20.01.2017, 18:46

Формы, механизмы, энергия наномира. Сообщение 84 660

Daren писал(а):У них есть определенные имена и фамилии. Достаточно хотя бы их озвучить или еще лучше записать видео такое же как с Шишкиным.

Кушелев: Мы с инвестором S в прямом эфире звонили в Дубну и общались со специалистом, который проводил эксперимент в Дубне: https://www.youtube.com/watch?v=FYIJILXT7gE

Изображение
Отметка таймера 26 минут 40 секунд. Послушайте. Очень содержательный разговор. Он состоялся 2016-12-02. Полтора месяца назад.

Изображение
Кушелев и Инвестор S в студии Глобальной Волны: https://www.youtube.com/watch?v=GEUXIPs1lJE
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#26 МАУС » 20.01.2017, 19:12

Кушелев, вы жалки и смешны, вы загадили форум своими глупыми фейками, в них если и поверит то только полный идиот, советую вам покинуть форум ГВ
- идите на свою "нанопомойку" там ещё остались кретины которые вам верят, а здесь, на форума ГВ вы не кому не нужны и не интересны, УХОДИТЕ!

Добавлено спустя 2 минуты 10 секунд:
Игорь Цветков писал(а):В следующей моей сказочке упыря отправят в ГУЛАГ на рудники. :biggrin: :blum1:
Давайте, ждём с нетерпением, надеюсь это будет феерично - Кушелев в ГУЛАГЕ)))))
МАУС
Аватара
Откуда: СССР
Репутация: 46 (+46/−0)
Лояльность: 55
Сообщения: 344
Темы: 9
Зарегистрирован: 30.05.2016
С нами: 7 месяцев 23 дня

#27 Kushelev » Вчера, 11:17

Формы, механизмы, энергия наномира. Сообщение 84 685

Готовится 587-ой выпуск рассылки "Новости лаборатории Наномир"

http://subscribe.ru/catalog/science.news.nanoworldnews

Дайджест:

587 Экспедиция к крупнейшему выпаривательному комплексу Ват и реке 1000 магнетронов.
Новая технология обнаружения кодов белков в геноме
Таблица митохондриального композиционного генетического кода
Изображение
ИзображениеИзображениеИзображениеИзображение
Изображение
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#28 Мукай Кусуй » Вчера, 13:32

опять Хороший сказочки
Мукай Кусуй
Аватара
Репутация: 57 (+57/−0)
Лояльность: -2
Сообщения: 86
Темы: 4
Зарегистрирован: 24.11.2016
С нами: 1 месяц 27 дней

#29 Kushelev » Вчера, 20:50

http://www.rcsb.org/pdb/explore/explore.do?structureId=2RQF

http://www.uniprot.org/uniprot/Q9U556

http://www.ebi.ac.uk/ena/data/view/AAF19267

>ENA|AAF19267|AAF19267.1 Bombyx mori (domestic silkworm) hemolymph juvenile hormone binding protein precursor
ATGGCTTCTTTGAAAGTATTCCTGGTTTTTGTGTTTGCTAGATACGTGGCTTCCGATGGA
GATGCTCTTCTAAAACCCTGCAAACTTGGTGACATGCAATGCCTTAGCAGTGCGACAGAG
CAGTTTTTGGAGAAAACCAGTAAAGGGATACCACAATACGACATATGGCCTATCGATCCA
CTAGTTGTGACGTCATTGGATGTAATTGCTCCCAGCGATGCGGGAATCGTGATACGCTTC
AAAAATTTAAACATCACGGGTTTAAAGAACCAGCAAATATCTGATTTTCAAATGGACACT
AAAGCGAAAACGGTGCTGCTGAAGACGAAAGCCGATTTACATATTGTTGGGGACATTGTA
ATCGAGTTGACCGAACAATCGAAGTCCTTCACAGGACTTTACACGGCCGATACAAATGTC
ATTGGAGCTGTCAGGTATGGCTACAATTTAAAAAATGATGATAACGGAGTTCAACATTTT
GAAGTCCAGCCGGAAACGTTTACGTGTGAAAGCATTGGAGAGCCGAAGATTACTCTCAGT
TCAGATTTGAGTAGCGCATTGGAAAAAGATTCCGGTAATAATTCCTTGGAACCCGATATG
GAACCTTTGAAAACGTTAAGACAAGCAGCTATTTGTAAAATAGCTGAAGCGTGCTATATC
AGTGTCGTGCACAACATTAGAGCTTCGGCCAAAATCTTACCCGCGTCAAGCTTCTTCGAA
AATCTTAATTAA

Изображение
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

#30 Kushelev » Вчера, 20:56

Формы, механизмы, энергия наномира. Сообщение 84 694

Пикотехнология белков, ДНК, РНК - 2

http://www.rcsb.org/pdb/explore/explore.do?structureId=1JEW

http://www.uniprot.org/uniprot/P78310

http://www.ebi.ac.uk/ena/data/view/AAC51234

>ENA|AAC51234|AAC51234.1 Homo sapiens (human) cell surface protein HCAR
ATGGCGCTCCTGCTGTGCTTCGTGCTCCTGTGCGGAGTAGTGGATTTCGCCAGAAGTTTG
AGTATCACTACTCCTGAAGAGATGATTGAAAAAGCCAAAGGGGAAACTGCCTATCTGCCG
TGCAAATTTACGCTTAGTCCCGAAGACCAGGGACCGCTGGACATCGAGTGGCTGATATCA
CCAGCTGATAATCAGAAGGTGGATCAAGTGATTATTTTATATTCTGGAGACAAAATTTAT
GATGACTACTATCCAGATCTGAAAGGCCGAGTACATTTTACGAGTAATGATCTCAAATCT
GGTGATGCATCAATAAATGTAACGAATTTACAACTGTCAGATATTGGCACATATCAGTGC
AAAGTGAAAAAAGCTCCTGGTGTTGCAAATAAGAAGATTCATCTGGTAGTTCTTGTTAAG
CCTTCAGGTGCGAGATGTTACGTTGATGGATCTGAAGAAATTGGAAGTGACTTTAAGATA
AAATGTGAACCAAAAGAAGGTTCACTTCCATTACAGTATGAGTGGCAAAAATTGTCTGAC
TCACAGAAAATGCCCACTTCATGGTTAGCAGAAATGACTTCATCTGTTATATCTGTAAAA
AATGCCTCTTCTGAGTACTCTGGGACATACAGCTGTACAGTCAGAAACAGAGTGGGCTCT
GATCAGTGCCTGTTGCGTCTAAACGTTGTCCCTCCTTCAAATAAAGCTGGACTAATTGCA
GGAGCCATTATAGGAACTTTGCTTGCTCTAGCGCTCATTGGTCTTATCATCTTTTGCTGT
CGTAAAAAGCGCAGAGAAGAAAAATATGAAAAGGAAGTTCATCACGATATCAGGGAAGAT
GTGCCGCCTCCAAAGAGCCGTACGTCCACTGCCAGAAGCTACATCGGCAGTAATCATTCA
TCCCTGGGGTCCATGTCTCCTTCCAACATGGAAGGATATTCCAAGACTCAGTATAACCAA
GTACCAAGTGAAGACTTTGAACGCACTCCTCAGAGTCCGACTCTCCCACCTGCTAAGGTA
GCTGCCCCTAATCTAAGTCGAATGGGTGCGATTCCTGTGATGATTCCAGCACAGAGCAAG
GATGGGTCTATAGTATAG

Изображение

Добавлено спустя 12 минут 22 секунды:
http://www.rcsb.org/pdb/explore/explore.do?structureId=1A4W

http://www.uniprot.org/uniprot/P00734

http://www.ebi.ac.uk/ena/data/view/CAJ01369

>ENA|CAJ01369|CAJ01369.1 Homo sapiens (human) prothrombin
ATGGCGCACGTCCGAGGCTTGCAGCTGCCTGGCTGCCTGGCCCTGGCTGCCCTGTGTAGC
CTTGTGCACAGCCAGCATGTGTTCCTGGCTCCTCAGCAAGCACGGTCGCTGCTCCAGCGG
GTCCGGCGAGCCAACACCTTCTTGGAGGAGGTGCGCAAGGGCAACCTAGAGCGAGAGTGC
GTGGAGGAGACGTGCAGCTACGAGGAGGCCTTCGGGGCTCTGGAGTCCTCCACGGCTACG
GATGTGTTCTGGGCCAAGTACACAGCTTGTGAGACAGCGAGGACGCCTCGAGATAAGCTT
GCTGCATGTCTGGAAGGTAACTGTGCTGAGGGTCTGGGTACGAACTACCGAGGGCATGTG
AACATCACCCGGTCAGGCATTGAGTGCCAGCTATGGAGGAGTCGCTACCCACATAAGCCT
GAAATCAACTCCACTACCCATCCTGGGGCCGACCTACAGGAGAATTTCTGCCGCAACCCC
GACAGCAGCACCACGGGACCCTGGTGCTACACTACAGACCCCACCGTGAGGAGGCAGGAA
TGCAGCATCCCTGTCTGTGGCCAGGATCAAGTCACTGTAGCGATGACTCCACGCTCCGAA
GGCTCCAGTGTGAATCTGTCACCTCCATTGGAGCAGTGTGTCCCTGATCGGGGGCAGCAG
TACCAGGGGCGCCTGGCGGTGACCACACATGGGCTCCCCTGCCTGGCCTGGGCCAGCGCA
CAGGCCAAGGCCCTGAGCAAGCACCAGGACTTCAACTCAGCTGTGCAGCTGGTGGAGAAC
TTCTGCCGCAACCCAGACGGGGATGAGGAGGGCGTGTGGTGCTATGTGGCCGGGAAGCCT
GGCGACTTTGGGTACTGCGACCTCAACTATTGTGAGGAGGCCGTGGAGGAGGAGACAGGA
GATGGGCTGGATGAGGACTCAGACAGGGCCATCGAAGGGCGTACCGCCACCAGTGAGTAC
CAGACTTTCTTCAATCCGAGGACCTTTGGCTCGGGAGAGGCAGACTGTGGGCTGCGACCT
CTGTTCGAGAAGAAGTCGCTGGAGGACAAAACCGAAAGAGAGCTCCTGGAATCCTACATC
GACGGGCGCATTGTGGAGGGCTCGGATGCAGAGATCGGCATGTCACCTTGGCAGGTGATG
CTTTTCCGGAAGAGTCCCCAGGAGCTGCTGTGTGGGGCCAGCCTCATCAGTGACCGCTGG
GTCCTCACCGCCGCCCACTGCCTCCTGTACCCGCCCTGGGACAAGAACTTCACCGAGAAT
GACCTTCTGGTGCGCATTGGCAAGCACTCCCGCACAAGGTACGAGCGAAACATTGAAAAG
ATATCCATGTTGGAAAAGATCTACATCCACCCCAGGTACAACTGGCGGGAGAACCTGGAC
CGGGACATTGCCCTGATGAAGCTGAAGAAGCCTGTTGCCTTCAGTGACTACATTCACCCT
GTGTGTCTGCCCGACAGGGAGACGGCAGCCAGCTTGCTCCAGGCTGGATACAAGGGGCGG
GTGACAGGCTGGGGCAACCTGAAGGAGACGTGGACAGCCAACGTTGGTAAGGGGCAGCCC
AGTGTCCTGCAGGTGGTGAACCTGCCCATTGTGGAGCGGCCGGTCTGCAAGGACTCCACC
CGGATCCGCATCACTGACAACATGTTCTGTGCTGGTTACAAGCCTGATGAAGGGAAACGA
GGGGATGCCTGTGAAGGTGACAGTGGGGGACCCTTTGTCATGAAGAGCCCCTTTAACAAC
CGCTGGTATCAAATGGGCATCGTCTCATGGGGTGAAGGCTGTGACCGGGATGGGAAATAT
GGCTTCTACACACATGTGTTCCGCCTGAAGAAGTGGATACAGAAGGTCATTGATCAGTTT
GGAGAGTAG

Изображение
Kushelev M
Аватара
Возраст: 55
Откуда: г.Дмитров
Репутация: -157 (+43/−200)
Лояльность: 323
Сообщения: 1146
Темы: 183
Зарегистрирован: 10.06.2015
С нами: 1 год 7 месяцев

След.

Вернуться в Флудилка

Кто сейчас на форуме (по активности за 5 минут)

Сейчас этот раздел просматривают: 1 гость

cron