Информатика: Музыка

Board index Общая ветка форума Обсуждение проекта

  • -1

#61by Kushelev » 04.03.2017, 20:38

Формы, механизмы, энергия наномира. Сообщение 85 887

Пикотехнология белков, ДНК, РНК - 2

В темпе коллагена

Письмо Дидье Маруани от Кушелева

Salute, Didier!
We met with you for more than 20 years ago.
Did you like the pyramid of the Rings: 

Image

But today I want to invite you to listen to music of collagen protein assembly:

https://cloud.mail.ru/public/HSGF/qsivVCegQ

Fragment 4/4: https://cloud.mail.ru/public/3DtJ/Q1kwN7Yfe

https://img-fotki.yandex.ru/get/94189/158289418.3d9/0_1750dd_7f614001_XL.png

https://img-fotki.yandex.ru/get/171919/158289418.3d9/0_1750df_e27de82_XL.png

Maybe the music will give you a new idea of a musical masterpiece ...
It is interesting to hear your comments.
Your Alexander Kushelev
P/S
This - the sequence of notes (MIDI).
Scores are generated automatically.
Compliance Table:

http://nanoworld88.narod.ru/data/212_files/0_4840b_b2101c2f_orig.png

Details: http://nanoworld88.narod.ru/data/212.htm

The protein molecule is built from amino acids.
Each amino acid resonates at a different frequency.
Building a protein molecule is accompanied by music.
This automatic music contained sizes: 4/4, 3/4 and strange
Copy on my site: http://nanoworld.org.ru/topic/1603/
Sorry my bad English and very bad French

Full secondary structure of collagen:

https://img-fotki.yandex.ru/get/100036/158289418.3d9/0_1750dc_302a920a_orig.png
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

  • 1

#62by искатель » 04.03.2017, 23:35

Наверное не стоит МАТ вражеский язык .

Потомкам славянских племен ,очень противен язык захватчиков , (я ни когда не соглашусь поменять Образное мышление ,на предметное ,ведь это деградация ), Нет я не хочу думать на саксонском ,мне мил славянский (куда более богатый , способный на передачу чувств ,эмоций ,настроений , ни один другой язык на это не способен , я не желаю быть животным .

Нет я не думаю ,что остальные ,отличные от молвы ,языки го--но , хотя ,,, если честно они конечно го--но .. потому как только на славянской мове можно передавать ,не только информацию ,но и чувства ,и настроения ,,,, да что уж там ,,, Иврит ,и Санскрит ,, так себе ,,А саксонский ,,Ну полное ,Го --в Но , да простит меня бог .

Я понимаю ,что не гоже скатываться в примитив , ну уж простите наболело , да и многие думают так же .
искатель M
ПРОверенный
Avatar
Age: 45
Location: с земли
Reputation: 264 (+275/−11)
Loyalty: 62
Posts: 1581
Topics: 14
Joined: 22.05.2015
With us: 4 yaers 2 months

#63by Kushelev » 05.03.2017, 01:24

Продолжение закрытой темы: http://nanoworld.org.ru/post/84572/#p84572
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#64by Kushelev » 05.03.2017, 01:30

Формы, механизмы, энергия наномира. Сообщение 85 905

http://globalwave.tv/forum/viewtopic.php?f=15&t=651&p=23778#p23778

искатель wrote:Наверное не стоит МАТ вражеский язык

Кушелев: Я изначально написал по-русски, потом перевёл для Дидье Маруани на английский, а русский оригинал случайно стёр. Ничего страшного. Текст простой, если нужно будет, восстановлю оригинал на русском.

Что касается "вражеского языка", то Вы, вероятно, хотели сказать, что у Вас нет друзей, для которых родным языком является английский? :) А если у Вас нет друзей, которые знают арифметику, то Вы её тоже вражеской будете называть? ;)

Кстати, Вы в курсе, что арифметика не передаёт эмоций?
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#65by искатель » 05.03.2017, 10:58

В том то все и дело , что друзья и родственники есть в швеции , вот я и заметил за собой , как постепенно начинаю мыслить предметно , что очень пугает .
Учить язык "Роботов" опасно , незаметно и сам им станешь .

Сравнение с арифметикой неуместно , в ней всего два действия , маловато для передачи чувств , в этом плане цифровая логика куда богаче .
искатель M
ПРОверенный
Avatar
Age: 45
Location: с земли
Reputation: 264 (+275/−11)
Loyalty: 62
Posts: 1581
Topics: 14
Joined: 22.05.2015
With us: 4 yaers 2 months

#66by Kushelev » 05.03.2017, 11:11

Формы, механизмы, энергия наномира. Сообщение 85 912

http://globalwave.tv/forum/viewtopic.php?f=15&t=651&p=23786#p23786

искатель wrote:Учить язык "Роботов" опасно, незаметно и сам им станешь.

Кушелев: А с чего Вы взяли, что английский язык связан с роботами? Когда появился в т.ч. английский язык, роботов ещё не было.

Кстати, слово "робот" чешского происхождения...

Из энциклопедии: Ро́бот (чеш. robot, от robota — «подневольный труд»)

А первые роботы (автоматы) появились более тысячи лет назад в Китае, Греции и др. странах.
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#67by искатель » 05.03.2017, 11:20

Александр Юрич , Ну я же взял слово Робот в ковычки """""" , ну если хотите "Зомби" ,, "Марионетка " "Робот" .

К стати это и называется Образным мышлением .
Last edited by искатель on 05.03.2017, 11:25, edited 1 time in total.
искатель M
ПРОверенный
Avatar
Age: 45
Location: с земли
Reputation: 264 (+275/−11)
Loyalty: 62
Posts: 1581
Topics: 14
Joined: 22.05.2015
With us: 4 yaers 2 months

#68by Kushelev » 05.03.2017, 11:22

искатель wrote:Сравнение с арифметикой неуместно, в ней всего два действия, маловато для передачи чувств, в этом плане цифровая логика куда богаче.

Кушелев: Как всё запущено... Вы даже не в курсе, сколько действий в арифметике...

Цитата: В арифметике рассматриваются измерения, вычислительные операции (сложение, вычитание, умножение, деление) и приёмы вычислений.
Конец цитаты.

Кушелев: Как тут не вспомнить пародию на Кашпировского:

"Я обычно считаю до трёх. Больше не умею..." :)

http://naviny.by/media/2012.10_w3/kashpirovski-anatoli.jpg
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#69by Kushelev » 05.03.2017, 11:27

искатель wrote:Александр Юрич , Ну я же взял слово Робот в ковычки """""" , ну если хотите "Зомби" ,, "Марионетка " "Робот".

Кушелев: По-Вашему Шекспир и Ньютон разговаривали на языке "марионеток"? А Вы в курсе, что всё, что угодно, можно перевести на любой язык? Более того, существуют слова, которые на всех языках звучат одинаково. С ними-то Вы что будете делать? :)

Цитата: ИНТЕРНАЦИОНАЛЬНЫЕ СЛОВА (ИНТЕРНАЦИОНАЛИЗМЫ) (от лат inter — между и natio [nationis] — народ) — слова или выражения, употребляющиеся во мн. языках с одним и тем же значением.

Added after 1 minute 39 seconds:
искатель wrote:это и называется Образным мышлением

Кушелев: Что-то я сомневаюсь, что Вы в курсе, что такое образное мышление...
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#70by искатель » 05.03.2017, 11:29

Как все запущено , Нет Дорогой их только ДВА . Сложение и вычитание . Умножение ,производное сложения , Деление производное вычитания .

А в природе только одно .

Ну вот нельзя поделить яблоко на яблоко , и после деления части яблока яблоками уже не являются .

Еще я сомневаюсь что можно перевести слово Здрасти на иностранные языки ,вот здравствуйте можно , в некоторых сочетаниях оно может иметь и неприличное значение а слова Хелоу ворлд такими свойствами не обладают .
Last edited by искатель on 05.03.2017, 11:45, edited 1 time in total.
искатель M
ПРОверенный
Avatar
Age: 45
Location: с земли
Reputation: 264 (+275/−11)
Loyalty: 62
Posts: 1581
Topics: 14
Joined: 22.05.2015
With us: 4 yaers 2 months

#71by Kushelev » 05.03.2017, 11:34

искатель wrote:Умножение, производное сложения, Деление производное вычитания.

И поэтому Вы заявляете, что в арифметике всего два действия? Но Вы же сами пишите: Умножение - производное сложения. Если сложение - действие, то его производное действием не является?

Added after 2 minutes 28 seconds:
искатель wrote:нельзя поделить яблоко на яблоко, и после деления части яблока яблоками уже не являются

Кушелев: У меня складывается впечатление, что Вы вообще не в курсе, что такое деление по определению...
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#72by Kushelev » 05.03.2017, 12:55

Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#73by Kushelev » 05.03.2017, 17:42

Формы, механизмы, энергия наномира. Сообщение 85 919

Пикотехнология белков, ДНК, РНК - 2

В темпе коллагена

Skype, 2017-03-05:

[13:37:39] Кушелев Александр Юрьевич: Привет, Валентин!
[13:37:46] Кушелев Александр Юрьевич: Когда планируешь приехать?
[13:37:57] Va12220(Valqwa): 7-9
[13:38:02] Кушелев Александр Юрьевич: Ты можешь добавить в программу ещё один столбец "кирпичиков"?
[13:38:11] Va12220(Valqwa): Думаю что конечно.
[13:38:37] Va12220(Valqwa): Описывай, что надо сделать.
[13:39:24] Кушелев Александр Юрьевич: Первый столбец - код 4, второй - код 6, а третий - набор кирпичиков, соответствующий названиям аминокислот (их там 23 вроде)
[13:39:51] Кушелев Александр Юрьевич: По названию аминокислоты нужно вставлять кирпичик с соответствующим названием png
[13:40:28] Va12220(Valqwa): а сейчас что там ?
[13:40:39] Кушелев Александр Юрьевич: Это будет выглядеть примерно так: https://img-fotki.yandex.ru/get/201221/158289418.3d9/0_174ffa_39bfeed1_orig.png
[13:40:39] Va12220(Valqwa): картинки кусочек отрисуй посмотреть
[13:41:02] Кушелев Александр Юрьевич: Я заменил код-6 на то, что должно быть в 3-ем столбце
[13:41:34] Va12220(Valqwa): не понял
[13:41:36] Кушелев Александр Юрьевич: В данном случае 22 кирпичика красные, а 23-ий (Gly) - голубой
[13:41:56] Кушелев Александр Юрьевич: Но я буду менять этот набор png-кирпичиков
[13:42:14] Va12220(Valqwa): вот хоть убей ( не понял
[13:42:16] Кушелев Александр Юрьевич: Один из наборов, когда один голубой, а остальные 22 красные
[13:42:45] Кушелев Александр Юрьевич: Для 9 типов коллагенов (и нескольких цепей для каждого) появилась специальная задача
[13:43:22] Кушелев Александр Юрьевич: Я по голубым кирпичикам (Gly) определяю ритмы сборки разных участков разных коллагенов
[13:43:59] Кушелев Александр Юрьевич: Ну и закрашивать 300 "кирпичиков" из 900 или 600 кирпичиков из 1800 вручную "не камильфо" :)
[13:44:21] Va12220(Valqwa): вручную не надо
[13:44:31] Кушелев Александр Юрьевич: А в будущем появятся другие частные задачи, где достаточно будет сменить набор из 23 кирпичиков, и задача решится автоматически
[13:46:25] Кушелев Александр Юрьевич: Может появиться и более специфическая задача или круг задач, где кирпичиков будет уже не 23, как аминокислот, а 64, как триплетов. Но там и работы с 64 кирпичиками будет больше, поэтому хотелось бы сначала иметь версию с 23 кирпичиками для каждой аминокислоты, а в будущем уже и с 64 кирпичиками для каждого триплета.
[13:46:57] Va12220(Valqwa): стой.

bs нарисуй - что есть и снизу что должно быть.
[13:47:55] Кушелев Александр Юрьевич: В левом столбце - код 4, второй стоблец - код 6, а то, что ты видишь по образцу во втором столбце, должно быть в третьем.
[13:48:09] Кушелев Александр Юрьевич: https://img-fotki.yandex.ru/get/201221/158289418.3d9/0_174ffa_39bfeed1_orig.png
[13:48:39] Кушелев Александр Юрьевич: Я второй столбец кирпичиков переделал в третий. А нужно, чтобы и второй остался и третий добавился
[13:49:01] Кушелев Александр Юрьевич: Сейчас сделаю монтаж
[13:49:08] Va12220(Valqwa): ниче не понимаю.
[13:49:35] Va12220(Valqwa): вижу сейчас
6 столбцов
1 2 3 4 5 6
[13:50:01] Va12220(Valqwa): что было и что должно стать?
[13:50:15] Кушелев Александр Юрьевич: Один момент
[14:00:48] Кушелев Александр Юрьевич:

Image
[14:00:59] Кушелев Александр Юрьевич: Примерно такая штука должна получиться
[14:01:34] Va12220(Valqwa): а была какая ?
[14:01:34] Кушелев Александр Юрьевич: Перед последним столбиком "кирпичей" нужны ещё обозначения нот, т.е. бука и октава
[14:01:48] Кушелев Александр Юрьевич: Было без последнего столбика "кирпичей"
[14:02:16] Кушелев Александр Юрьевич: А буква и октава - табличные данные. Я тебе таблицу напишу.
[14:02:31] Va12220(Valqwa): пиши
[14:03:45] Кушелев Александр Юрьевич: Айн момент
[14:09:29] Кушелев Александр Юрьевич: Вот в этой таблице: http://www.nanoworld.org.ru/data/01/data/texts.rus/9990520.htm
В предпоследнем стоблце - частоты, а в последнем номера нот в стандарте MIDI.
Сейчас я попробую восстановить буквы по номерам MIDI или по частотам. Номера миди взяты с транспонированием на +5 по отношению к частотам. Именно такие ноты с транспонированием мне и нужно видеть между вторым и третьим столбцами "кирпичей".
[14:10:54] Кушелев Александр Юрьевич: Я тут подумал, что может быть не имеет смысла заморачиваться с двумя наборами (23 и 64 кирпича), а сделать сразу один (64) по числу триплетов.
[14:11:34] Va12220(Valqwa): правильно подумал
[14:12:48] Кушелев Александр Юрьевич: Я бы и символы между стрлбцами кирпичей сделал бы универсальным набором, чтобы его тоже можно было менять под новые задачи
[14:13:14] Va12220(Valqwa): тоже правильно
[14:13:35] Кушелев Александр Юрьевич: Тогда просто по триплетам выводи два набора по 64 "кирпича", а я эти наборы сделаю в фотошопе
[14:13:37] Va12220(Valqwa): т.е. хочешь сказать что бы они были "внешними" так же как и "кубики" ?
[14:14:13] Кушелев Александр Юрьевич: Ты выводи .png такого же размера, а я их сделаю в фотошопе
[14:15:10] Кушелев Александр Юрьевич: Цифры и буквы я сделаю на "белых кирпичах" чёрным цветом, а последний столбец для первой задачи такой и будет, как здесь:

https://img-fotki.yandex.ru/get/94596/158289418.3da/0_175193_e4c18e2c_orig.png

[14:15:46] Кушелев Александр Юрьевич: Просто я обнаружил ошибки в названиях нот в этой таблице: http://nanoworld88.narod.ru/data/212_files/0_4840b_b2101c2f_orig.png
[14:16:25] Кушелев Александр Юрьевич: Поэтому наборы "кирпичиков" лучше, т.к. помогут исправлять ошибки, замеченные в будущем
[14:16:25] Va12220(Valqwa): 1 - такое "триплет"
[14:16:42] Кушелев Александр Юрьевич: Триплеты - во втором столбце
[14:16:50] Кушелев Александр Юрьевич: Это генетический код аминокислот
[14:16:59] Кушелев Александр Юрьевич: Для глицина триплет GGC
[14:16:59] Va12220(Valqwa): ttc aag и т.п. ?
[14:17:04] Кушелев Александр Юрьевич: Да
[14:18:14] Кушелев Александр Юрьевич: Короче нужно добавить два столбца "кирпичей" по 64 штуки в каждом наборе.
[14:18:22] Кушелев Александр Юрьевич: А я их разрисую
[14:19:11] Кушелев Александр Юрьевич: Каждый кирпич лучше всего прямо так и назвать: aaa.png ... ttt.png
[14:19:54] Va12220(Valqwa): хорошо
первый набор кирпчей назову именно так по названию аминокислотных остатков (триплетов)
[14:20:01] Va12220(Valqwa): а второй как обозвать ?
[14:20:17] Кушелев Александр Юрьевич: А второй, вероятно, aaa2.png и т.д.
[14:20:42] Va12220(Valqwa): тогда будет aaa1 и aaa2 png
[14:20:48] Кушелев Александр Юрьевич: Правильно
[14:21:25] Кушелев Александр Юрьевич: А размеры такие же, как и у тех, что уже есть. Я сейчас буду "делать кирпичи"
[14:22:42] Va12220(Valqwa): размеры такие же
[14:22:48] Кушелев Александр Юрьевич: ОК
[15:00:23] Кушелев Александр Юрьевич: Набор "кирпичей-2"
[15:00:41] Кушелев Александр Юрьевич: Это для последнего столбца "кипричей"
[15:01:09] Кушелев Александр Юрьевич: А для предпоследнего сейчас сделаю ...
[15:03:18] Va12220(Valqwa): монстр
[15:27:48] Va12220(Valqwa): получил
[15:27:51] Кушелев Александр Юрьевич: Тестировать программу можно на этих "кирпичиках". А потом я номера доделаю для остальных белых, которые в наборе N1
[15:28:04] Va12220(Valqwa): хорошо
[15:28:22 | Изменены 15:28:35] Va12220(Valqwa): но вывод кирпчиков будет соответствовать "триплетам"
[15:29:40] Кушелев Александр Юрьевич: Да
[15:32:17] Кушелев Александр Юрьевич: Файлы fasta / dne для тестирования можно взять здесь: http://nanoworld.org.ru/topic/1575/page/91/
[15:32:31] Кушелев Александр Юрьевич: Там именно файлы коллагенов
[15:33:16] Va12220(Valqwa): любой из двух ?
[15:34:39] Кушелев Александр Юрьевич: Да
[17:11:30] Кушелев Александр Юрьевич: Привет, как программа?
[17:12:08] Va12220(Valqwa): делаю.
[17:12:11] Va12220(Valqwa): приступил
[17:13:10] Кушелев Александр Юрьевич: ЗдОрово!
[17:13:25] Va12220(Valqwa): а можно уменьшить 'ne твою колагеновую структуру раза в 4ре ? и на ней тренироваться ?
[17:13:39] Кушелев Александр Юрьевич: Да хоть в 100
[17:14:57] Кушелев Александр Юрьевич: А кирпичики, вероятно, лучше по отдельным папкам разложить, чтобы они не перепутывались с другими файлами
[17:15:14] Va12220(Valqwa): так и сделаю .. конечно же
[17:25:37] Кушелев Александр Юрьевич: Тут ещё одна задача нарисовалась: "Найти генетический код белка по ... нотам": http://nanoworld.org.ru/topic/1600/
Для этого нужно написать программу, которая конвертирует ноты, например, из файла MIDI в последовательность символов, обозначающих аминокислоты. Правда, там есть одна хитрость. Ведь одной ноте соответствует иногда несколько разных аминокислот, а значит придётся выдать не одну, а набор последовательностей. Если хотя бы одна из них совпадёт с последовательностью реального белка из базы данных PDB, то это - удача. Но эта задача на будущее. Сейчас интересно с "кирпичиками" доделать.
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#74by Kushelev » 05.03.2017, 18:06

Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#75by Kushelev » 05.03.2017, 22:20

Полноценный вариант сообщения можно посмотреть по одной из трёх ссылок:

Формы, механизмы, энергия наномира. Сообщение 85 924

Пикотехнология белков, ДНК, РНК - 2

В темпе коллагена

Image
Кушелев: Профессионал сразу нашёл ноты, которые ни я, ни участники форума лаборатории Наномир найти не смогли.

https://img-fotki.yandex.ru/get/94596/158289418.3da/0_1751b6_92a72168_XL.jpg
Вот они, ноты из "Сказок Венского леса" Штрауса!

Но и ему не удалось найти эти ноты здесь: http://www.notarhiv.ru/zarubkomp/shtraus/noti/1%20(47).pdf

Кушелев: В чём же дело?

Михаил: А их там просто нет.

Кушелев: Как же так? Это же ноты тех же самых "Сказок Венского леса"!

Михаил: "Федот, да не тот"

Кушелев: А что, бывают разные "Сказки Венского леса"?

Михаил: Бывают разные ноты. В интернете ты нашёл упрощённый вариант.

Кушелев: Понятно. А я уже подумал, что ничего не понимаю в нотах и музыке...

Михаил: Ты просто нашёл упрощённый вариант произведения Штрауса, где этих нот просто нет.

https://img-fotki.yandex.ru/get/95629/158289418.3da/0_1751b7_49bb2ec7_XL.jpg
Кушелев: Да, здесь нижняя нота повторяется, как в собачьем вальсе. Это - в чистом виде музыка сборки активного центра коллагена!

Михаил: Вариант аккомпанемента без чередования практически не используется даже у классиков. Это примитивный, устаревший вариант.

Кушелев: Это и понятно. Ведь коллагену больше миллиарда лет!

Михаил: Скока скока?

Кушелев: Больше миллиарда.

Михаил: Тогда понятно, почем нет чередования.

Кушелев: Да, в новом миллиардлетии положено вместо одной нижней ноты играть две. Например, ми-ля-ми-ля.

https://img-fotki.yandex.ru/get/56796/158289418.3da/0_1751b8_77fa8be5_XL.jpg
Здесь, кстати, два раза подряд повторяется музыка сборки активного центра белка коллагена.

https://img-fotki.yandex.ru/get/3902/158289418.3da/0_1751b9_b4be4304_XL.jpg
Михаил: Кстати, это не "Сказки Венского леса" Штрауса, а "Щелкунчик" Чайковского.

https://img-fotki.yandex.ru/get/53680/158289418.3da/0_1751bc_c8361df1_XL.jpg
Вальс цветов.

Кушелев: -А где "Сказки Венского леса"?

https://img-fotki.yandex.ru/get/196365/158289418.3da/0_1751ba_f87aedde_XL.jpg
Михаил: Вот они. Здесь тоже нет чередования. Правда музыка сборки активного центра белка коллагена не повторяется дважды, как у Чайковского.

https://img-fotki.yandex.ru/get/195431/158289418.3da/0_1751bd_b99e3af_XL.jpg

Кушелев: Это понятно. Чайковский же позже Штрауса писал, вот и удвоил :)

https://img-fotki.yandex.ru/get/109111/158289418.3da/0_1751bb_7dff7cb3_XL.jpg
А почему в Internet этих нот нет?

Михаил: Потому что в инет выложили упрощённые ноты Штрауса. Сократили раза в полтора...
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#76by Kushelev » 06.03.2017, 09:17

Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month


#78by Kushelev » 07.03.2017, 16:59

Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#79by Kushelev » 07.03.2017, 17:23

Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

  • 1

#80by искатель » 07.03.2017, 18:51

да ексель моксель , вы спектр отдельного элемента видели?
Это уже аккорд , они как минимум из 3-5 " нот" состоят , только протий это одна красная полоска .
Обратите внимание на углерод .
Attachments
C.gif
C.gif (3.17 KiB) Viewed 5075 times
искатель M
ПРОверенный
Avatar
Age: 45
Location: с земли
Reputation: 264 (+275/−11)
Loyalty: 62
Posts: 1581
Topics: 14
Joined: 22.05.2015
With us: 4 yaers 2 months

#81by Kushelev » 07.03.2017, 20:32

http://nanoworld.org.ru/post/84701/#p84701

Собственные частоты радикалов аминокислот лежат в более низкочастотной области. В ней и формируется музыка сборки белковых молекул.
Last edited by Kushelev on 07.03.2017, 20:35, edited 1 time in total.
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#82by Kushelev » 07.03.2017, 20:33

Формы, механизмы, энергия наномира. Сообщение 85 997

Пикотехнология белков, ДНК, РНК - 2

Виртуальные "кирпичи" для музыкального плагина программы "Пикотех"

Skype, 2017-03-07:

[13:06:43] Кушелев Александр Юрьевич: Привет! Хорошо бы первую и вторую серию "фасты" обработать новой версией программы, т.е. с крупными символами.
[13:07:18] Кушелев Александр Юрьевич: Ну и конечно же миди-файлы интересно для всех белков вывести.
[13:08:14] Va12220(Valqwa): Сейчас занят. Вечером буду разбираться
[13:11:11] Кушелев Александр Юрьевич: ОК
[13:13:16] Va12220(Valqwa): По миди, ты пока что подумай.
там 7 столбцов. Что такое столбец каждый - я тебе написал.
образец того, как заполняет столбцы неделько - тоже перед тобой.

ты вчера сказал, что совсем не так там все как надо заполнено. попробуй написать - как должно быть заполнено )
а я уж заполню.
[14:40:20] Кушелев Александр Юрьевич: Я же написал, что Неделько всё правильно сделал. Точно так же нужно сделать в твоей программе.
[14:40:41] Кушелев Александр Юрьевич: В программе Неделько я пока ошибок не обнаружил.
[14:41:35] Кушелев Александр Юрьевич: Ты можешь скормить программе Неделько таблицу из 64 триплетов и посмотреть, что за миди-файл она выдаст. Твоя программа должна выдать такой же миди-файл.
[14:54:35] Va12220(Valqwa): Ну расскажи как он сделал )
[14:54:38] Va12220(Valqwa): Не могу
[14:54:59] Va12220(Valqwa): И не хочу смотреть что там внутри наворотил Неделько
[15:48:25] Кушелев Александр Юрьевич: Я не знаю, как он сделал, но я знаю, как увидеть отображение таблицы:
[15:48:49] Кушелев Александр Юрьевич:

00 AAA 66
01 AAC 71
02 AAG 66
03 AAT 71
04 ACA 76
05 ACC 76
06 ACG 76
07 ACT 76
08 AGA 62
09 AGC 81
10 AGG 62
11 AGT 81
12 ATA 72
13 ATC 72
14 ATG 67
15 ATT 72
16 CAA 67
17 CAC 69
18 CAG 67
19 CAT 69
20 CCA 93
21 CCC 93
22 CCG 93
23 CCT 93
24 CGA 62
25 CGC 62
26 CGG 62
27 CGT 62
28 CTA 71
29 CTC 71
30 CTG 71
31 CTT 71
32 GAA 67
33 GAC 71
34 GAG 67
35 GAT 71
36 GCA 93
37 GCC 93
38 GCG 93
39 GCT 93
40 GGA 55
41 GGC 55
42 GGG 55
43 GGT 55
44 GTA 79
45 GTC 79
46 GTG 79
47 GTT 79
48 TAA 115
49 TAC 62
50 TAG 115
51 TAT 62
52 TCA 81
53 TCC 81
54 TCG 81
55 TCT 81
56 TGA 115
57 TGC 76
58 TGG 62
59 TGT 76
60 TTA 71
61 TTC 67
62 TTG 71
63 TTT 67

[15:49:35] Кушелев Александр Юрьевич: Надо просто "скормить" эту таблицу программе Неделько и она сохранит midi-файл. И ты увидишь, что в этом midi-файле должно быть.
[15:51:05] Кушелев Александр Юрьевич: Подготовить тебе файл fasta с таблицей?
[15:55:02] Кушелев Александр Юрьевич: Вот все 64 триплета подряд: AAAAACAAGAATACAACCACGACTAGAAGCAGGAGTATAATCATGATTCAACACCAGCATCCACCCCCGCCTCGACGCCGGCGTCTACTCCTGCTTGAAGACGAGGATGCAGCCGCGGCTGGAGGCGGGGGTGTAGTCGTGGTTTAATACTAGTATTCATCCTCGTCTTGATGCTGGTGTTTATTCTTGTTT
[15:58:43] Кушелев Александр Юрьевич: Вот файл fasta с таблицей композиционного генетического кода:
[15:58:45] Кушелев Александр Юрьевич: >ENA|TKGK|TKGK Homo sapiens (Kushelev)
AAAAACAAGAATACAACCACGACTAGAAGCAGGAGTATAATCATGATTCAACACCAGCAT
CCACCCCCGCCTCGACGCCGGCGTCTACTCCTGCTTGAAGACGAGGATGCAGCCGCGGCT
GGAGGCGGGGGTGTAGTCGTGGTTTAATACTAGTATTCATCCTCGTCTTGATGCTGGTGT
TTATTCTTGTTT
[16:04:11] Кушелев Александр Юрьевич: Вариант для программы Неделько (dne):
[16:04:12] Кушелев Александр Юрьевич: ID TKGT; Kushelev; linear; mRNA; STD; HUM; 192 BP.
FT CDS 1..192
AAAAACAAGA ATACAACCAC GACTAGAAGC AGGAGTATAA TCATGATTCA ACACCAGCAT
CCACCCCCGC CTCGACGCCG GCGTCTACTC CTGCTTGAAG ACGAGGATGC AGCCGCGGCT
GGAGGCGGGG GTGTAGTCGT GGTTTAATAC TAGTATTCAT CCTCGTCTTG ATGCTGGTGT
TTATTCTTGT TT
//
[16:06:40] Кушелев Александр Юрьевич: Вот, вполне разумный миди-файл, который сохранила программа Неделько. Каждая нота соответствует триплету, который подан на вход.
[20:20:20] Кушелев Александр Юрьевич: Кстати, ты можешь по кодам глицина формировать удары в барабан-1 (бас), а по кодам пролина формировать удары в барабан-2 ?
[20:22:35] Кушелев Александр Юрьевич: GGA, GGC, GGG, GGT - Басовый барабан, а CCA, CCC, CCG, CCT - барабан-2
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#83by Kushelev » 07.03.2017, 20:51

Формы, механизмы, энергия наномира. Сообщение 86 002

Пикотехнология белков, ДНК, РНК - 2

Виртуальные "кирпичи" для музыкального плагина программы "Пикотех"

Письмо Дидье Маруани от Кушелева

В темпе коллагена

Image
Оригинал: https://img-fotki.yandex.ru/get/197756/158289418.3da/0_17548d_8f4651bb_orig.png
8 разных цепей человеческого коллагена.

Интересно разобраться с третичной и четвертичной структурой коллагенов, а так же с музыкальными особенностями сборки этих необычных белковых молекул.
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#84by Kushelev » 07.03.2017, 21:47

Формы, механизмы, энергия наномира. Сообщение 86 004

Письмо Дидье Маруани от Кушелева

Didier wrote:Dear ALEXANDER can you please send me MP3 on my personnal mail,
Because I cannot listen with your links
Kushelev: OK!
I sent letter to You now
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#85by Kushelev » 08.03.2017, 10:56

Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#86by Мишка Коробков » 08.03.2017, 16:06

искатель wrote:вы спектр отдельного элемента видели?
Это уже аккорд , они как минимум из 3-5 " нот" состоят
Александр Юрьевич сам придумал логику сопоставления кодов с нотами (читай "постулировал", как в прочем все его идеи по сути строятся на постулатах, хоть он и пишет
Kushelev wrote:Я рассчитал их относительные собственные частоты колебаний по формуле, объединяющей формулу математического и пружинного маятников.
но даже обращая внимание на 3 его "паузы" (а это просто нота с частотой звука в 0 Гц) он совершает логическую ошибку: что эти белки не имеют массы? имеют - тогда почему одни звучат а другие молчат? так задумал Кушелев!) - поэтому кроме как выдумке автора, научной фантастике со слабой аргументацией, к его версии относится вредно - слишком далеко здесь от познания Реальной Природы,

а вот если послушать через спектры (а там всего 4 ? элемента - азот, углерод, водород, кислород) - то можно ближе подойти к музыкальности белков, хотя 4 аккорда тут будут звучать всегда, разница только в "силе" каждого (акцент по колличеству того или иного элемента)?...и тут возникает ещё вопрос - почему эти 4 элемента, которые в общем-то состоят из одних и тех же протонов\нейтронов, имеют многозвучие - почему пара\несколько нейтронов\протонов не усиливают свой единичный звук, а рождают биения на других частотах? вот здесь можешь раскручиваь свою версию по ритмодинамике - в этом есть смысл :) хотя в первую очередь интересно заглянуть внутрь и увидеть причину, а не просто факт рождения биений (а ритмодинамика говорит только о частотах, но не заглядывает внутрь, она даже среду, в которой происходит распространение колебаний, ставит далеко на задний план)

кстати, беседовал с другом биохимиком, на сегодняшний день встретилось только 32 кода, а не 64 как говорит теория\математика, и работают действительно только 4 основания (это их перебор даёт 64 варианта) - тоесть даже здесь реальных кирпичиков 4 а не 64
а по поводу сложности задачи поиска первичной структуры белка - нет в ней никакой сложности, просто оборудование дорогое, а так это чисто техническая задача вроде скормил материал для анализа а машина сама определяет структуру...

и по поводу перескока с катушек на рубины - на катушках то тоже ничего Кушелев не сделал реально рабочего - так, только помечтал и порассуждал и перескочил (а как говорит история и опыт перескакивание через ступеньки только рвёт штаны...потом всё равно вылазят проблемы, которые надо вернуться и решить на предыдущем этапе),
вот и смотри теперь реально на то, чем занимается Александр Юрьевич - писатель-фантаст, коллекционер рубинов, да ещё и публично сознался ранее, что распродаёт свою (или всё же инвесторов?) коллекцию без стеснения про это говорить вслух
Мишка Коробков M
АдминистраТОР
Avatar
Age: 41
Location: Харьковская область, Украина
Reputation: 63 (+63/−0)
Loyalty: 232
Posts: 791
Topics: 15
Joined: 17.04.2015
With us: 4 yaers 3 months

#87by Kushelev » 08.03.2017, 19:09

Формы, механизмы, энергия наномира. Сообщение 86 027

Пикотехнология белков, ДНК, РНК - 2

http://globalwave.tv/forum/viewtopic.php?f=15&t=651&p=23838#p23838

Мишка Коробков wrote:
искатель wrote:вы спектр отдельного элемента видели?
Это уже аккорд , они как минимум из 3-5 " нот" состоят
Александр Юрьевич сам придумал логику сопоставления кодов с нотами (читай "постулировал", как в прочем все его идеи по сути строятся на постулатах, хоть он и пишет
Kushelev wrote:Я рассчитал их относительные собственные частоты колебаний по формуле, объединяющей формулу математического и пружинного маятников.
но даже обращая внимание на 3 его "паузы" (а это просто нота с частотой звука в 0 Гц) он совершает логическую ошибку: что эти белки не имеют массы? имеют - тогда почему одни звучат а другие молчат? так задумал Кушелев!) - поэтому кроме как выдумке автора, научной фантастике со слабой аргументацией, к его версии относится вредно - слишком далеко здесь от познания Реальной Природы,

Кушелев: Что же Вы поторопились "сесть в лужу"? Паузы - это терминирующие кодоны. На них музыка заканчивается, т.к. они останавливают строительство белковой молекулы. По трём командам из 64 не ставится никакой аминокислоты. Кстати, недавно мне удалось выяснить, почему стоп-кодонов целых три. Ведь все три триплета означают одно и то же. Типа: "стоп", "конец", "финиш". Любопытные могут узнать, почему в генетическом коде используется "тройной финиш", а в более древнем, но тоже композиционном коде митохондрий стоп-кодонов было даже 4(!)
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#88by Kushelev » 08.03.2017, 19:25

Мишка Коробков wrote:если послушать через спектры (а там всего 4 ? элемента - азот, углерод, водород, кислород) - то можно ближе подойти к музыкальности белков, хотя 4 аккорда тут будут звучать всегда, разница только в "силе" каждого (акцент по колличеству того или иного элемента)?

Кушелев: А если бы Вы ещё мои ответы читали, то смогли бы прочесть, что атомные спектры лежат в более высокочастотном диапазоне. Наглядно это можно представить следующим образом.

Музыкант ударяет молоточками по плиткам металлофона или ксилофона:

Image

Мы слышим тональные звуки плиток (пластинок) и в более высокочастотном диапазоне звуки ударов молоточков. Кстати, молоточки часто делают мягкими, чтобы убрать эти высокочастотные звуки. Тональные звуки соответствуют звучанию радикалов аминокислот, а сами удары молоточков (отдельно их можно услышать, ударив одним молоточком по другому молоточку) соответствуют атомным спектрам.

А дальше анализируйте свои слова:

Мишка Коробков wrote:если послушать через спектры (а там всего 4 ? элемента - азот, углерод, водород, кислород) - то можно ближе подойти к музыкальности белков, хотя 4 аккорда тут будут звучать всегда, разница только в "силе" каждого (акцент по колличеству того или иного элемента)?

Теперь Вы поняли, что Вы говорите не о "музыкальности белков", а о "паразитных звуках типа молоточек по молоточку"?
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#89by Kushelev » 08.03.2017, 19:26

Image
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

#90by Kushelev » 08.03.2017, 19:30

Мишка Коробков wrote:кстати, беседовал с другом биохимиком, на сегодняшний день встретилось только 32 кода, а не 64 как говорит теория\математика, и работают действительно только 4 основания (это их перебор даёт 64 варианта) - тоесть даже здесь реальных кирпичиков 4 а не 64

Кушелев: Покажите другу-биохимику код любого коллагена. Пусть убедится, что там встречаются не только 32 кода: https://img-fotki.yandex.ru/get/197756/158289418.3da/0_17548d_8f4651bb_orig.png

Image
Kushelev M
Topic author, ПРОверенный
Avatar
Age: 58
Location: г.Дмитров
Reputation: -114 (+53/−167)
Loyalty: 13
Posts: 1304
Topics: 42
Joined: 10.06.2015
With us: 4 yaers 1 month

PreviousNext

Return to Обсуждение проекта

Who is online (over the past 5 minutes)

Users browsing this forum: 1 guest

cron